Description :
From Genome Similarity Track
Location :
Scaffold_250:49022- 53033
Transcript NameFunction/comments
Hyaar_Emoy2813175hypothetical protein

Sequence
4011 bases(100 bases per row)
GCGACGGATGCCGGGCAAACCTATCAAATTCGCTGAAAAACTACTGACAATATTTAACGCTGGATACGACTTAGTAAAGTTCAGCCCGAGTTACTGTGTG
CGACTGTCGTCGAACCGCTGGCGGACTTGGATCAGTAAGGATACCTCAATGTCCTGTATGTATTACTACTTAGATAGCCGCCTTTGAGTATGAGGCGAAC
GTAGTGATGTCGCAGAACAAGGCTGCTGCATACCACCTTTCCAAAGAGGTGCGCACGGCAGTATATAGCATACTTTGCAAACCTGCCAACTGGCATCAGC
ACCTGACCTAATCACCTGGATAATCAATATCTCGAACCTCAGTGCTGAGGGCATCTTGGATCCGCTAGTGGCTGGTCATCACGGAGTGCGTTAAACTTTA
CTCTTTTTCATATCTTACCGAGCGACCGCGTGCGATCGACATGACTGAGAATTCTCCGGTCAGCTTCAAAAACGGCAGATCTTCCCAACGTCGTCGTAGA
CTCATGGTAAAGACTTACCGGCATCCCCGTGAAAGCACCATCCATCTTCATTTGCAGAATGCCACGGGATTCCCAAATCATCCGGAACGCCGTGTAGCAT
GGTTTATACGCTCTTGGCAGCGCGAAGCAAGGGGTTCCATTGACATGTCTCTTTTAAAAGAAACAAGGGTCACTCTGGGTAAGTCAGCAACTATGGAAAA
AGATGTACAACTCCACCTGGAAATTCGTGGACGAACAGGACGCTCGCTGTCGACATAGTTTGAGAAATCTCGTGGAGGAATGGCTATTTTATTGAGCCCG
TACTCATCGATTACTAAAATAGATCCGTAGCATGAGAAGTATTGAACACCACACTGGAAGGCTCTTAGAACTAAATTTTTGTGCGAATCTGTCCTTTGTT
ATCAATTTTTACGCACCAATTGATATGACTGAAAAGGAGGCGTTTTTCGAGGAGCGTTCTAAGAGTGGCTCCAAACTAATAAATTGATCATATATGTATT
GTCGAATGCTAAATTAGCACTTTAAAAGACGAACGTCTTTGATAATGGGACAAAGCAGCTTTCTATTGGATAGTAAGTTCCGCGGTGCTGGGCTGGACGC
CGTGACGACTAACACATCACCGTCTGTTGTCCCAGCGCCATTTCGGACGATACGACGATCTATGCAGCCACTCGGACGATGTCTCTTGCCTGCCCTAGTT
TGTGACCAGGTACGTAAATATGACATGTATATAAAGATCCAGGTATGTACAATACGGCGTGTGTATAGATGTATAGATCGTGCTTGTTCGTATATCACCC
CTAACGATCTGGTTATTATTAAAGTCGAGCTCCGACTCTGTTTTTCAGGCTGAAATATGAGTATCATTAATTAGGTTTACTTGTTGTTGGTTTCGTATAA
GCGGGATGAGTGGTGATGCAAAGAAGCAAGTTCTACTGATGCTATTGGGGTGGATTGGAATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTACGACACT
TAATTCTGAGAAAGATTCTAAGTACGGTATGCACTTAGCACCTTTCATGTGGTTGAGGTAAAGCAATAACGTACCTACCACAAAGTTTGTGACACACACG
GATGAGGTTACTACTTGACGTCACGAGATGAAGTCATTGAAGTTCGTCATCAACGCGCTTGTATTGAGTTTAAGCGCGCTGTAGAGACCGCATCTCATCT
GAGCGCGCGTCGAATCTTTTGTCTTTTAGCCAATAGACATTTAGAATATGTTTGGTTAGTTCTATAAGAATCAGTCTGATATTCGCAACCTATTCATTAC
GTGTGTACAGGAGGACATGAAAACCCGTCCGAGCCACACTAAACAACAGCATTCACCTATCGGTGCGGCAGTAGTAAGACGCCCACCCGAACCTCGCTGC
ACGCGAAAGAAGACGGTAAAAACGCTTCCTCGCAAGTGCCTGAAGGTGTGCGTAGAGGTAGTGTGTGGCTGCTGTAAGCGCCCGCCTACACGGAAGAAGC
ACTTTTGCACAGTCGAAACGAAGCACCGCGGTGGCCCCCACGCCATTTTGTATTTATTCGGCTCATATTCTGTGGCTTTCGGTTTCATTTACTAAATGTA
CGTACAATGCTTATTTATGTAGAGGAAGCAGGTGTGGTCTTTTCAAATACGCTTCGGTAAACAATTATTTGTCGCTCTTTGACGAAAGCTACGGTATCAC
AAGAATAAAGTTGTCAAGGAAGGAGCCTACGAAGCAGTGTGATGATTTATCAAGAACAAACCACGTACCAGATAGTACTGGAAGCTGGATACAAATGTTA
TATGAGGCAAAACTTGACAAGGAATAGTCTACTTTCCGAAATGAAATAAATAATGAGCTGTCATTGTAATAAATAACTTGTTTTATCAGGTCACGAAGTA
AATCTATTTGAATAAATAGTTCACTTTGTTAGACTTTTGTTATGCACTTTATAAGATAGTTGGCCACTAGCCTATCGTTATCCAGCCCTCTAAATTAAAT
ATGCCACATTATTAATTTAGAGGGATGGATAATGTGATCTCTATCTCGTGGTTACGACCAGCAATGAAAAGTGACGACGAAGCACAGAAAAGAAGAAACT
TATTTAAAAAAAGGTGTTACGCTTGCAAAAGAGATGTCATTCGAGATTTGATCGATCTTAACCGAAATTGCAATCGTCCATTTTGTGTAGTGACAACCAG
TGATACGAGGCAGTTTGCACACAAAATGGCTGTTTTATTTGTTGTACAGTTTGCCTTTTTGCGCACATTCGTCCCACCAAAGAAATTTGCCTGCACTCTT
GTCAAGTATCCGATTCTTCGAAGACTTCTCACAGATATGCAACTAAAAAACAATTTGCTAAATGCTTCAGTGAGATATATGGCCATGCTCTCCGGCCGAA
AAATAATTCGAATGGAGTTAAAGGAAGAAGGAATTTCCGCAATGCACATGAATTGTGTTAACGCATAAGAAAGGCTGAAGCTGGAAATATTTGGAATTGG
TATTGAATAATTTACGCTTATTCTGTCCAAAATCGCTGCAATGATTATTCCAGGTCAAAAAGCCAAGCTTGAAATGGCGAATGGTGACTTCAAGCGGTAC
ATTATTATTATTTGAGAAGTGCTTCAGGTGGAGGAGCAATACAGTGAGCGTGGTATATCCGTCGATGGAACACTTATGAAGCCATCAGTCGTTATAATAA
TTGTTGTAGTGTATTTCGTAATGGAAATAACGAGATATAAATAATTGGAGTGGGGCTTGCATCGACGGAAATAAGGATAAATGTACCTAGTTTAAAAAAT
TCACACTTTCTCAACTCCAACCAGCTCCAGCTTTCGTGAAATATTAGACAAGGCCAAGGGGCTGATGAAAGCTATGCATACGACTGCATCAGACGTCCCA
CATGTTTATCTTCAGGTACTTGATGGAAAATTTTAACAAGAAGTACAGGGCCAATATATCAAATGTTTTGGTGTGGATTTACGCTCGCGCACGAAGTAAG
GGTGGAGTACGAGAAAGCAGTAACGTATATTGTACATTTGGATAGCACTACGTTAGCGTGGCTTCAGGGGTGGGCCGTGAAAAATGGTTAACAGCTTATA
TCCATGCTCAAGATACAACACATTGACATCAGACAATGTAAATCGGTAAACATCTTGTTTGAGAATTCGCTCTCATCCTGTCATACTGCTTGATGGGTAT
AAGCGTCACGT