Description :
From Genome Similarity Track
Location :
Scaffold_447:490077- 491695
Transcript NameFunction/comments
Aphin_H310_09251Hypothetical protein

Sequence
1618 bases(100 bases per row)
CACTGGACTTGCCAATGCATCCCAATGCACGCCGTGCACGGGTGGATCCTTTTGCAGCATGACTGGGCTCTCAATTCCAACCGGACCGTGTTTACCGGGA
TACTACTGCGTTGCTGGTGCTATCAACTCCCGAGGTCAGCTCAGCTCGAATGGAACCGTGGGTAGCTGTCCTGCTGGAAAGTATTGTCCTGGGGGCACGT
TTTTGCCCCAGCCTTGTCCACTAGGAACGTACCTGCCATCGGTGGGTGGAATCGCTGTCGAAGATTGCTTGCTCTGCCCTGGAGGGTCGTATTGCAACGT
GTCCGGGGCGACCGCCCCCAGTGGTTTCTGTGCTGCGGGGTATTTCTGCTATCAAAGCAACGTGTCTCCTCAGCCGACAAGCACCAGTGTGACAGCCTCT
GGCGTGGCTGTCGGCGGAGATATTTGCCCCACGGCGCACTACTGCCCCTCGGGCTCGAGCATGCCAATACCCTGTGCCCAAGGCACATATGCCATCACCC
CAGGCATGTCCGCCTGCGCGACTTGCCCTGCAGGTACATGCAGACATTGCACCTCCTTCAACCTGACAAGGAATGAACAGGATATTATTGCCCCACTGGT
ATCGACGCCTTCCACTCGTACATATGCCCTGCTGGGTACTATTGTCCAGCAGGCACAACTCGCGCCGACCAATTTCCATGTCCCCAAGGGTCGTTCAGCA
ACCAAACTGGGTTGACCAGTGTCGGGCAGTGCACATTGGCACCTGGCGGGACGTTTGTGAACATCGTGGCGGCAACCGCTCCGACTGGAAACTGCTCGAG
CGGGTACTATTGCATTGGCGGCGCCTTGAACGCAACCCCAACAAATGGCCCTCTCGGCGGCCTCTGTCCGTTGGGAGCGAGTTGTCCGTCTGGGTCGTCG
CTCCCGACGCCTTGTAAACCAGGTTTCTACTGCCCAGACATTTCCACGACATTGCCGTGCAAAGCAGGCTTTTACTGCATACAGGTACACACGACGAACG
GTGCGATTTCGAGCGTGACAAGTGTTGACCAGGGCTCGTACACGGACACCCCGACCGGACAAACGAATTCGTTTGGCGTGATCGGGAATGAGTGCCCTTT
GGGAAGTTACTGCCCAGAGGGATCTAGCAACCCCACGCCGTGTCCTGCGGGTACCTATGGGAAATCGAAGCAACTCAAGGATGTCTCTGGCTGCACGAGC
TGCGACCCAGGATTTATGTGTCCGACAACCGGCCTCACAAGTGCAATAGTCCCATGTACAGCCGGCTCGTACTGTCCTGGTGGCCAGAAAAGTGCCTCGG
AGCACTTCTGTCCTCTTGGCTCCTCTTGTCCGCAAGGGTCCATCGCGCCGCAACCATGCGCCGCGGGCAAGTATGCTGACCAAACTGGACAGGTTTCGTG
CCAGACGTGCCCTGCGGGGTTTTTCTGCGTCAGCGGCTGCATCACGCCTGAGTCATGTCCCCAAGGGTACTATTGCCCCAGCGGCACTCAAAATGGGACA
AGTCTTCGCTGTCTTCCAGGCACCTATGGTGAATTCATCCAACTTCAGTCCGCGACAAACTGCACCAACTGTCCACCGGGCAAGTTCTGTTCTGGCCTTG
GCAATACTGGTACCCAAC