Description :
From Genome Similarity Track
Location :
Scaffold_179:490- 3580
Transcript NameFunction/comments
Phyta_totarag5135hypothetical protein

Sequence
3090 bases(100 bases per row)
TCGCCACACATTTCGACAACTCTGAACGGGCCGTACCACTGGTGTGATAGCTTTCTACTCGGTCCTGGTTGGACGCGGGGAATATGCAGCCACATATCTT
ACTTCGTATCCAGCCTTTATGCGTTCTGACAATTCTCGCCATTTCTTAGTCTGTTCTTCCGAGCGCAtgttcttggccttcttctgcaagtATTTGGCAC
GCGCGAGGGCATAACTATAGTCCCTCGGAAACTTCGTCTCCACTCATATGCGGTGCTTTATGGCGCGCTCGATGGTTTCAGATCTAGCATAGCAGAGGTC
GTCCCTCGCGCGTCCCAACCGCGCACCAAGTAGAAATGGAGTGTCGAGACGGGTTGCATCAAACGACGTGATCAATACAAACATCAATCGTTCAGTGAGC
TGGTCCCAGTCGCTCTGGTCTGCCTCAGTGATGTAGGCCTTAACGCTGCACATGCCCGTCTGTACAGACCATTCTTGCTGTCCGTTCACTTGTGGACGAT
AGGCCAACATGGTCCTTTTTTTACTGCCCAAGAGTTCCCTGAACCGCGCCAACACCTCGCTCACGAACCGAGGGTCCTGGACATGACGTAGCATGGAGCT
TGCTCCAAAATGTCGAAAGACGCACTCCTCAAAAGCCTTGGCCACTTCTTGGGCGTCATTGAGCGCATGGGTTTGCAAATTACGTACCCCGAAAATGCGT
CCCGGAAGAGAAGTAGGAGCCTGTTGCCGCGATCTCTTCGGCATGTGTGTCACAAAATCCATTGACACAACCACGAAAGGACGTCTCGGCTCGATATTCC
CGGGCGAAGGTCCAGGATTCGGCGATCGCCCCTTGGCAGCCGCACAATCCACGCATTCCTTAACGAATCTTTCCACATCAGCATACATCTTCGGCCACTA
GAATTAACGATGTAAGCGTTCATACGTTCTCGTGATGCCTTGGTGCTCGCCCTGATAATCCTCATGTGCGAAATGTAACATGTCAGAACGCAGTGCTTCT
GGGACGACTAGTCGGAGCGCTGATGCCACACGATAGGGACGATCCTTGGTTGATCTGTTTAGACGATGTAGAATGTCACGTGAGTCCAGAGCGAACAAAT
CAGCAATCTTGGCAATCCGCTTGAGTTGAGGTCGCGAGAACGCGTCGAAATATCCGTTTAGACACCGATTCATCTGTACCAGGAGTGCGTCGCTATCCTA
GTGCACTTTGATCCAACGCCACCTCTCAGCTTGACATTCCAGAGGTCCTCTTGGTTCACCCTGACCAGACCGGATAGCACGTTGGGTCACTGTAGCCACA
ACTTTGACGGCATGCGTCAGTGGAGCTGATTCTGGTCCCGGTGCGACAGCATCTTGGCCTACTGCGTCCTGGTCACATACAGCCTGGAGCTGTGTGTCAT
TTTCTGGTTTCATCAGTTTCTCTTGAATCGCAGTCACCATACGCAAGTGTTCCTTttcatcagcagcttcgaccTCCCACGACGCGTCGAGGACGAGCGT
CTTGGAGGTTATGTAGTCAACGACCTGGTTGTATGCTCGCTTTACGTGAACCAACTTGACCGACTTGAACTTGGCCTTCAATGATTTAAACTTCACTAAC
ACACTGTAGATTGGCCTGGTGACAATTGATGAGTCCTTGTGATTATTGAATAGCAATCCTGGAATTACCTACTACCACCAAATCCTAGATGCAATGTTCC
AGAGCCAGCTTCATCCCATTCCCCAGACCGCATTACTAACGCGTCATTGACAGCCACCTCCTCCAGGAAATAGCCTCGAGCATCTATGACGCGCCATCCT
GGGAGTTGCCAGAGAATACATCCGCAGCTACCTTGGCCGTTGGATGTCttagcagcaccaccaatGCTTAGGCCTCATCCTTCGTAATTGGTCTCCAACA
GTTCCATACGAATAGGAGGTGGAGCCTTGAAGCGCCCCTTAGCAGGGATAAGTGTTCTGCCACTGTGTCCAAGCGTTCTCGTGGGGTAATTCTTGCATCC
ATTATGGCCGCCAGTCCGTCTTCACCGCGGTTCATTTTGTAAATATCCAAGGACCACGACATCAATGCTAGCAACAATTGAGACACCGACCGTCCTTGGA
GCTGGACTTTAACAGCCAACTTAACACGGAGTACCTGGTGTACACCTTGATTCGGGAACGGAGATGTCGAAAGTATCGGCCGGAAGGTTTCCAGGACGCG
TAATACTGCTATGACTTCACTTCCATGATGTGGTAGCGTACCTCCGATTCGTTCAGGATGCGACCTGTGAACCGTACCGGTTGAACTACGCATCATACTC
ATGTCCTAGCACAGTGGCTGCTGTCCAAGGGTTTGCATGGGGAATGATGACGAAATGGTTCGGGCGATCTGGTTATGTAGCaggagggggggggcacaAT
CATGCATTTTAGCAGCTCGAACGCGTCCTTCACCCTGGCCAAATCTCGGCCAGAACGCACTTGCTCATCGGTCAACTCGTACGATACAGCTGTGATCACT
GGCAGATCCTCGATGTAATAGTTCAGGCTGCCGAGAAACGACTGCACTCCTTTCAACGTGGGTGGGAATGGCAAATCCTGGACACTTTTGGCGATCTTCG
GCGTCGCTCGAATTCCTTCAACGTTGATCTCATGCGACAGATACGGAATGGTCGGCTTGCCGAACTCACATTTAAGCCGACTGACCGAGATGCTGGATGC
TCCAATATCGCAATCGATATAACAACGCATTCAGGTCCTCGCACAGCTGCCCTCTAACATTTCCTAGTCAACTTAAGCCTCTTCATCCGTCGGGAGCCTC
TCAAATTCCCACAGACACTTGTTGATGACACATTGGTACATCAGAGGAGCGTTTATCAATTCAAACGGTATCCCGACCCACTGGAAGTACCCGAAGGGAC
GGGTGAACGCTGAGACTAATTTGACTCTCTCGGACATCCGGATCGCCCAGAAACCACTTGTCATATCCAGACTCACGAACCACATCATGTCTTCGAATCC
AATGAGTAGGTCGTCGATCAGCGGTGGGTATTGTGATAATCTGATGAATTCGTTCACCACTCGGTAGTCGATGCACATCCTGATATCTAC