Description :
From Genome Similarity Track
Location :
Scaffold_632:490- 2394
Sequence
1904 bases(100 bases per row)
CTTCAGCTTTGGACACATGTACCACCGCGAACAACCGATAGGGCGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGAAA
TGGTCCATAACACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATCGCG
GTTTCGTTATGACGATCCGCTCGGTCTTGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACCTCC
ATCTTTTGGGATCGCGATCGCGGGGTTTGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGGCGT
TTCTCCGCGGACTCGATGTTGCGCTGTATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATTTTG
ATCAATCGTGTCAGAGTTTGAACCTTGCGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGTTGA
ACGCTCGGAAGAAATCGGACATAAATCCTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTCTTC
GATCGTCTGTGCAGTTTGTGACGAGCTCGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATCGTG
GTAGAGACAGAATGTGATTCATGGCCAAAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCGGTT
TCACAATTGACGCACTCGCCTATATAGCGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTCCTT
GGTGCCCGCCGTCCAACCTAGTATGGTAATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCTTTT
TGCTGCTGCCCTAGGACAGGAAAATGAAAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGCATG
GCTATATCCCCAATCAGATACGCTTTCAAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTTCTT
CTTGCAAAACTGCCGGGTAACATCGTCTTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGAGACAGGCTTGTCTCGGTATCAGTAACTCATTCAAC
CGATTAAGCGTCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTGGT
TCCAGTCCCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAATC
AATTTCGCCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACCCTTTAGCCTGATTAGCCAGTAAATCAAACCAAGCAATAGCC
CACGGTATTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAATATCGCACTGTAGGC
GACGCCCTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGGTTCGTCTGCTTCGACCGTGGGTGGTAGTATGCTTATGGTTTGCCGTGGCT
GTTT