Description :
From Genome Similarity Track
Location :
Scaffold_4686:490- 1839
Sequence
1349 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTGTTTAGCCGCCCACTGGCGCGGTGTATCTACCGCCACGCCCACGATGGGCTCCG
CGGGAAGCGGTGTTGGAATTCCCTCCAACGTGTTGATGACCCAACGCTGGGCAGTCGCGCTTGAAGTGACCTGCCTTGCCACAGTTGTAGCAATGCAAGT
CAGCGCGCTGCCGGTCAATTGCATTGACGTCCATGGGCGTCGGCCCACTGGACTGCATTCTAGGTGGAATGAGAGAGCCAGACCTCGCTTGCTTCAAGCT
GTAGTCCTCTCGTCGAGCGATTTCGATTGCCTCTTCGAACGTCTCGGGAGACGAACGGAAGAATTGGTCACGGGGAGGACACACGCGAAGTTTCTCCATG
AAGACCGTGACCAGAGTTTCCTTGCGTAATGGTTTGGCAGCCGTCGCTACGATCTACTCGCGTAGCTCACACACGAAGTCACTGAGCTCACGATTTCCCT
GCTTGCAAGCAAGAAACTTCGAACGCAGCCGAAAGGCCATATTCGGATGCTGGAAAGCCTTGCGCAACTCCGCGCGAAGAACTTCCCATGTTGGGAACGC
TTCAAAGGAGTCTGTACTTCTGGTAAGGACCCATGTCTTGGCCCTACCACCAAGGATGGACATTGCAAATGCCACATTGAGACGTTCATCCCGAAGGAGA
GCTGCGTCCATTGCAATCTCTACTTCTTTGAACCAGAAGATGAAATTCTCGGACTCCTTGTTCTCGTACTTTGGCACTGCCAAACGTAGTGGCTTCGCTC
TGGCGTCATACGCCCGCGTCGATGACGCATGCGGAGCAGACGCACTGGGCGCTGTCTCTCGCGCATAATCGGCCAAATTACCTCGAACAACAGGTGCTGA
CTGGTGTGATGAAGCGGATGCGCTTTTGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTCTATCCAGGTGTCCA
GGAATTGGTCAATACCTCTCACTGTGTACCCTTTAGTTCTTTTGATCTA