Description :
From Genome Similarity Track
Location :
Scaffold_405:49- 2960
Sequence
2911 bases(100 bases per row)
AATCGGAACGTGCGAACTTCTCTTGAGCACATGCGACTGCATGTCGCGCGACTCGTTCATCCCCCGGAGCACCGCCCACCCTTCGACTGCAGTCGTTGTG
GCCACCACGTGCAGCACTTGCGAGTCGGTCAAGCTGAGCACGATCGCCGCATGCGCTTGCTCCATAAGGGAGAGGTCGAGCGGCGCGCTCCCGTCCACTT
GCCCCCACAGTCCTCGAGACCGCAGGTACATCTTCATCTTGAAACTCCACAGCGGGTAGTTGGTGCCGTCGAACTTGTCGACCTTCTCAAACGTAGTTGG
GCTCATAACCTGTTCGAATGCTGCAGAGCTACTGAGGTGAAGGTACTGTTGCTAAAGTGGTCAAAGCAAAAAGTGAGTTGTATTCGTGCGGCTCCGTGTG
CTTGGAGCTATTGGCTGTGAGCCACTCATTCTTCTGTCCTACCCTCCTTGCCTTTGTGTATCCCTCTGTGGTGTGTCCTACCTTTTGGTAATTACGTCTT
GTAAAAACCCTCGGTAAAAAACCTCACTGTGTCATATGCAAAACTGAAGGCGATTGCGCGGCCCCCTTCCCAAACGACTAAGCCAATCTGTTGCCCCTGA
CTCAGTCACGACGCACTTCACAAGCATAATATGCATCATATAACCTACACATCCAACCGCGTACTTGATCACTTCTAACAGAGATATCTTCTGGGCCGCG
CAACGACAAACGATTGTTGCCATTCCTTGCGCCCGAAGCAGAGAACACGGATGGTGCAAAAGCAGCTATGAAGTTTATGTGCAAAACATTATACTTAAGG
CGCTACAGGCCTTGAAAGTGAACGTTAACATCGCCATATATATTCAAGCGGCAATCGTGTTGAGTGCATATCCCACATACAGCAGATAAACAAGACGTAT
CGAGATTAAAAGAAATTACATTCGTGATATGATACAGACGGGCTAGTTAATGATGCGCAAGATTTAATCCGAGAAGAATCCTGCGGATATGCTGAAGAAG
GCACTCCCGAGCCATTTTGTACTGATTCTATGATAACTTGCAGGGGTCAGGGTGCCATATTAGTCCAACCCTATCAGCGATAAGAGCTACGTGTCGAATG
GTGGCGTGTTGAAATCCTTTAGGCTCGGATCAGACAAGAGCTGAGCCCATTCTCACTTGGGAAGATATATGTGCAGCCAGGAAGTACGGGAAGGGTATGT
AATACAAATAGTTGTAGTGCGTAAAGTTATATGTAGATATAGTGTCAACACTAGGATCTAGCAAGTCTTTCTACTTGCTGGGTCAGTCGGCGCTTTGATT
GCGAGTCCGAAGGGCGAAGCTATTAGTGACTGTGCGCAAGGTTGAACGCCAAAATTTTGAATCGTACTTATATGTGTGTGTCGGTAAATAACGCGGCTAG
ATGTACATTATACGTACTAAGTATGATCTAGCTTGTCCACCTCATTGGTCGATTAGCATGATAGATGTCACTTTTAGGTAAGTCACTAATTGCGATTGCA
TCGATAGTAAAAGTCGCACGACTAGCGCACGCATGTTATTAGCTCAAAGGTCGTACGGGGCTAACAAATGTCAAAACCGAAAACGCACGATCCTTCAGGG
TGGACAAACAGGGATGATATGACTGACTGTATTTGTTGTGTTTGGTTAAATTATGATTTATTATAGGGAATTTTTAAATGAACGCCTTAAAGTTGTGGTA
TGCACTCCTTTTTTGGCTGGCGTAGGCGACCGCAGGATCATATTGTAGCCAGGAGGTTCAAGAAATTATGGACGCCTTGTTCAATGAACGCCTATTATGA
GCTAGCGTGACTGACCGTAGCTGCGATTAATTGTGAGGAGAGTAAAAAATTAAAAGGTCGCGGAGCAGATCACAAAGTAGCCTTGATTTAACTAGGTGCA
TGCTCACCCCACAAGAACAGACTGATGAAACATACATGAATCTTCGTACCTTCACTCAAATTTTCCATCTCTTTTACACCTTCAGCACTTCCAGCACTAA
TTTCTTTATGTTACTTTTTAAAGCGCGGAGATGGGCACCACAGGAACTGCGCACTTGTGCAAGCTGTTACTGCAACTCATTCTTGATGCGATGCAGCTCA
AAATTCCCGCCTGCTTCTGAAAGGTCGCTCTTGCTGGATGCCGGCACCAACGCACGTCCCTCTTTAATAAAACACTGTGCAATTGTCAGGTCCATGTGAA
TTATCTTAGTATCGCCCATATCTTAAACGGAAAGCATCAAAAACGGAAAGTTTCTTACGCTTTACTTCATCGCCGAGTACCTACCGTATCCACGTGCTCG
TAGGGGCGTCCGTGAGTTTTTCATGGCGCTTCTACCAAATCACGTTTCTTATAGGCCTAAAAAGAGGATGACAACTCACGTTAGCAGGTAGTGTACCGAA
GCCAAGTCAACACACATCACGTACATAGGATTAGTAAGAACACGAATGTTGCGCACAATCCTGTCAAGCAACGTCTACTTGACGACTTTCGGACGACCAA
CAATCGTCAGCTTAATCGTTCGCGGCTGAGCACGAGTACAAAACGACCTCATCAGCAAGTTATTAGCATCCCTGAATTCATCTATCAGCTCTCGCAACGT
GCATCGTCCTGTGTAGTTGAAAACAAGACTGTCGCCTGATATGCAAGAGTGGAAAAGAAAAAACGTTTCGATAAAAGGGCGTGCATTTAACAACATCGAT
CAATACTTTTCATAAGGCGTACATTTAGTAATTTTGGGGGGCGTGCATTTAACAATTCCCTTATTATCATGTCATGATTCGTACTTTATAAATAAATGAT
CGTAATTGTTATCGTTATTGTGTCGAAAGTGTATCAAAACGTTTATACCAAAAACTTTCGGATTAAAGTATTCAAGAACCTATCCATCTCTATTTATATA
TAAAAATTGCA