Description :
From Genome Similarity Track
Location :
Scaffold_258:49- 2292
Sequence
2243 bases(100 bases per row)
TACTGCTACGAAAGGAATCCACGAAGGCGGAAACTGGGGCGTGGTGTCGAAGAATGATGAGGATCAGGTAGTCTTGGGCTGAACATTGAAGAACTTGCTC
ACTAGACGCTGGATCTGGCGTCCTGGGTGTTGGCTCAGGTCCCCGCGAAACTGGATGCGCCAAGGCTCGGCTTCGTCGATCTCTCGCAAGGCTTCCAATA
GGCTCGTGGGTTCTGGGCGATGGAGGTTGGGATCCTCCAAGTTGGCTTGACGGGATACGGATCCCGGAAACCAAGCTACCTTATCCCCGCGTCGGCAAAG
ATGCAAGAAGGATGGATCCAGCAAAATATCCACGTCACACCAACCGTCCTGGATTGCTAACACGAGGATCACAAGGACTCTCTTCCAAGCTCGGCCCGCA
TGGCTACGCCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAGGTCGAACCCTGCAATTGATTCCGAGAGATGGGGAACCGGTGAGTGCCCTCACATA
TAGCAACCCGGTGCTTGGAGACGAAATCCCGGAACGCCCGAACGAATACCCCGAGTCGCCCACGCACATCACCCCTGAAGCTAACCGGATCCACCGGTGT
GGTGACCAGTGTATCCCACGGGGCAGCACTTGTCAGTTCCTCCACGAGGGGTCTGGTGATGAGCGAATCCACGTACCCGGCCCTCGGGATGGCGTCCGCT
GTCCGAGGGAATATCCACTCAGCCCGAAAAGGCAACTCCGGAAACAGAACCGTGATCTTCATGGAGATGATCGCAACTCGGTTCAATTTCTTGGCTGACC
AAGGCTCGATGTCTCTGGCAGCGAAGGCCACAGGAGCACGTCTACCAGGAATGAAAGCAGCATCCGGACCGAACGGAGCCACGGGGAGCATCCCTGGCAG
TGACGAGTTAGGGGGGGGCGGGGATCAAGACAGATCCAGGGGATCCGCCACCGTGAGGCGATCCCGGGGATCCGCCACCATGAGGCGATCCTGGGGAACC
GCCACCATGGGGCGATCCTGGAGATCCACCACCATGAGGCGACCCCCCTCCACCAGATCCGGGAGATCCGCCACCAGGCGCCCCCCCTCCGCCAGATCCA
AGGAGTCCGCCACCACGAGGCGACCCCCTCCCACCATCACTGCCCGATCCACCGTCACTGTCGACGTGGATCGCAGATCCCGCAGTGGCGCCTCCGGATC
CGGCTGTGCCAGCGACTTGTAGAGGCGGCGTTGAGAGGGATCTCCGCCGGGCTTCGGATCGGGATTGGGATAGAGCCCGCCGCGTGTCTTCCTCCAAGGC
CTCCTCAGCGGTTCGAGCCTCCTCCGAATCCTCTGGACTCTCGTCGTCATCGTCGTCGTCGTCATCGTCCTCATCGCTTAGAGTGAAGGGATACGGGCCG
GCAGACGGCGCACGCTTTGACGACGATCGGTTAGGAGGCCCTGAGCCGTCGGACCAGTCAGATTCCTCATCCTCATCGTCCTCCGAACTACCCAGTCCAC
ACCCAGGGGGAATGACGCGTTTAGCTTTCCCCTTCCCGGGTCCAGTACGGGCCGGCGGAGGGTTGGTGGAAGCGGACTGAGGAACGGCGGGCGTCGTCAC
CGAAGGACCAGCGGTGGATCCCGTCTTGGACGTCGATCCCGGTTTGGATACGGCCGTAGACCCAGTCTTGGACGTCGTAGACCCAGTCTTGGGTCCGGAT
CCAGATTTTGACGCAGCAGCGGCGGATCCCGTCTTGGACGTCGATCCCGGTTTGGATACGGCCGTAGATCCCGTTTTGGACGTAGCAACGGGTCCAGTCT
TGGACGCCGTAGACCCAGTCTGGGGTCCGGAGCCAGACTTGGACGTAGTGGTAGATCCAGTCTTGGACGCCGAGGTAGACTTGGATCTAGCGGTGGATCC
AGACTTGGATCCGGCACCTGACTTCGAGGGAGAAACGGAAGTCTTGGGCGCGGGTGTAGATCCTGCCTTGGACACAGAAGTGGATCTCGCTTGCGGAGCA
GATTTAGAAACCGGAGTCGTTTTGGGCTTGGCTTTCGGGGAAGCTCGGGCCTGCTTATGGGGACGGGAGGATCCGGTGCTAGGAGCGGGAGATGTACTAC
GCGGGCGTTTCGCAGTCGACGAATCCGCCCCACTTACCGTCGGAAGAGGAGCAGAAACGCTAGCGGCCTGAGAGGGCCCCGACAAGGGAGGAAGTGGATC
CGAGACGGCAGCTGTCACCAGCGCCAGTCGTCGACGTGCCAAA