Description :
From Genome Similarity Track
Location :
Scaffold_3571:49- 2236
Sequence
2187 bases(100 bases per row)
GCTTCTACCGAATTATAACTAGAACATCTTGAGGCGACACTGTTGAGGTGCACATGAGTTGAGTTCCGGCCCCTCTATCGTTCCTGCAGCTTCCGTGCCA
CAGCGGTAAGTCTCCCCACAACAAGGAGAATGAGACCTTGGAGATGGAATTTCGTTGATGTGTCCCATGTCTTATTATGCAGTTCCAACGGCGATGTATC
TGGGACGGCCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCGCAACCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCG
GATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATG
CTGAGAAGTGTTTGACCTTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGTAGATCCACCAGGAACAAGTGGCCGGATTTGC
TGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCACTAGAATACCT
ACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGTTCCAAGGTACTGCGGGAAAACGTGGATCATTTCATCGAGACGGTG
GGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTCCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCC
AGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCACCTGACTCAGG
AACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACAACGAAGACCGGAGACAAC
TCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACCGGACAGCACAAGTCAGGTCTTCGCAGTGCGGATCCC
GGAAGCACACTGAATCTGGATGCTGGAAACACCTGGTCGGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTG
TGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAA
GTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAACCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATC
GCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGGCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCT
TCAGCCCTGGATCTACAAAGGGGAGAGGCACGCGGTTTCTGGGAGAAGCGTCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTTACTGCAGATC
CACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCACGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAATACCATGC
CCCAGGAAAGTGGTTCAGACAAGCCAAGGTAAGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGAT
ACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAAGCGTGTACCGTACGAATGGGAGAACGC
GGATCAAGATCATGTTGGCAGGTTGTTTGGTGTACTGGTTTGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTTATGGT
ACCAGCCGGAGTGAGGTTGGATTTGGCGGATGGGACACTTTGTTTCCCCAACGAGATGCGGATCCAGCTTAGCGGACGGCGACCGTTGTACGGGGTGAAG
ATGAGGATCATAAGGGGCCTGGATCGATCCCGGAGAGACCTGGGAGCTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTG