Description :
From Genome Similarity Track
Location :
Scaffold_4711:49- 2030
Sequence
1981 bases(100 bases per row)
TCGGCCCGTTCAAAAATGCGGTCGTTACATCCATTTGGTGTATCTCGTAGTCTCGGACTGCCGCATACGCTAGCAAGAATCGCAGCGACTCGTACCGCAC
CACTGGGGCAAAAACTTCATTGTAATCGACGCCGTGTTCTTGCAAGTAGCCCTTGATCACTAGTCTTGCTTTGTATCTTTCGATCGTGCCATCAGCATTG
TACTTCTTGCGAAGGACCCACTTGCTCTTGAGGATCTTCATACCTTCAGTCCTTGGCACTAGCTCCCATGTTCCATTGGCAACTAGTGATTCAAACTCGC
TGTCGGTCGCTTTCTTCCATTGCAGATACTCTGGTGACGCCATGGCTTCTTCCAGCGTCGCGGGCTCTTCCACGACAGCGACTGACGCGGCCATGACATA
CGCTTCCACATTCCATTTCCTGGTGACGCTCTTGACAAATCGCTTCCTTGCCAATTCGTCTGCCGACTCGAGTTCTTTTGCCATCAACACGTGCTCGTTC
ATTCATCTTGGCGGTTTTGTCTGTCTGCCACTGCGTGTTGTCTGGACCTGCGTCCACGACGAGGGTTTGACTGGCCTTTCCGCTACTGGCTTGTCTTCTG
TACGTGGTCGCTTGACCGCTGTCTGTTCACTGCTGCTGTCTGGCGTGCGCTTCACACCAGTTACTGCTTCCATGCCACTGGTTGCCGTAGTCTCGCTCAT
CTCTCTCCCATCGGCTGTACCCGGTGTCGACTCTGTGGCATGTCTTGACTCTCTTTCATCATCTCTCGCTGTAGCCCCACCGCTTCTTTGCACTGCAGTA
CTCGTGTCCTCTGTGACACGCGCATCCACTGGGATGCTTGGTTGTGGACCGGTCCTCTCTTCCGCGTTGATCAGACGCGGCTGTCCCTCAGTCTGCGCAC
GGCCTGCACCGATCTCGGGATCGCGTGCGCCGCTGTCTTTCGCCCCATCAGCTTCACTACTGATAGCACGCTGCACAATGCGCATCTCTTCTGCATTCTC
TTGTGGCAACACGTAGTCGTATAGGTGGGCGACAGCTTCAAGGTCTCTGACCACACTCTCTTCTAGCACTGATACTCCGTCTCGCTTCCCTGCTTTCTTG
GCAGCCGCTGTGTCCTTCTTCTGCTGTCGGCGTAGCTGCCGATTCTTCAGTGCTTCCTCCGGCGTAGCCAATTTGGGAAACTTGCACTCGTTGAAGATCA
CTGTGTGGCTGTACTTGTGCTTGAGAGTCTCACAGTCGATCATTTTGTAGCCTCGTCAGTCGGTCGGGTAGCCGACAAACATCATTCTCTTGGCGCGCTT
GTCACATTTCTTTCTTTCGTCTGCTTCAACGTACACCCACGCTTCACAGCCAAATACACGGAGGTGCCACATCGGCGCTTTTCTCTTGAACTACAGTTTG
TATGGCGGCACCATTCCTGTCCACTTGGCTGGTAGTAGATTCAACACGTNNNNNNNNNNGCCACAGTTTGTATGACGGCACCATTCCTGTCCACTTAGCT
GGTAGTAGATTCAACACGTACGCACTGGTGATTGCTGCTTCGGCCCAGAGTCGCTGATCGAGGTTTCCATGGTGAAGACAGCAGCGGATCTTCTCACACA
CTGTTCTGATCATTCGCTCTGCTACACCGTTCTGCTCTGGGGTCTTCTTCATCGTGAGTGTACACTCCATCCCGAGTTCTTCTTCACACATCTTTTTCAA
CTTGACGTACTCTTGCGCGCCGTCCGACTGCAAGCTCTTCATTCTCACACCCAGTTGTGTCTTGATCCTTTTGTAGTACTGTCGGAAGCACTCGTAGACT
TCCGATCTCTCCTTCAGCACGAAGAGACTCACAAATCTGGATGCATCGTCAACAAAGACACAAAAGTAGCAACAGCCAGAGTATGACGCAATGTGGTACG
GCCCCCAAATATCTGTATGCGCCTTTTCTCCGACTGCCCACTGCTTTCTGTCCTTGCTCTTGCCCTTGCTCTTCTTGAAAG