Description :
From Genome Similarity Track
Location :
Scaffold_3543:49- 1860
Sequence
1811 bases(100 bases per row)
TTCGGTAAAATAGGCGCACTTGTAGTTGTTTCATAAAAAGAAGTTTCACCCGCGGACTTTGTGGAGAGGTGGTGGACCTTAAACTCAGCGGAAAGATCGT
TCCCGAAGGGTATCCGAGAAGCTAAATAATAACCGTCACTGCTTGTTTTTCATCTCTCGCGATGGGTACATGTACGCCAGTTGCGAGGAAGGTTGGAGAA
TTGATGAATTTCGGCGTAGGCACTTGTTCAGGATGTTCTCTCTTGAACGCTGAGGTTGCAGAAGAGACCGGCATCTTGATTGTGTATTAATTCCGGTGCA
ATGTACAGTAACCACATTTCCATTCGGGTCATCTTGTTGCCCTCCACTTCACTCGCTTGAGCTGCTCCCATCGTAATGGCTGCTAAAACAGACTCGCGTT
TGCAAAGTGCCCTAGTAGCCACACACGTAAACTTGATACGACGACGGTGGCAACCTTCGCTTACACCGCCACACCCTTCACAGTGGAGCGAAAGGACGCC
CCTTCATGTCGCGGCAAGTGACTGCAAAAGCGCTGAAGTCGCGGAGAAGAGGATTGGCGACGATTTGATCATCGCCGCCAGAGCTGCGACGTGCTGCGCG
TTTTGAGCGGAAACGACGATGTCTGCAGCGTCGTGAGAATGGGCAACAAAGCATACCAAGTCAAGTCGGCCCTCATGAGAGACCTAGCGTCGGATGCCGA
GAAGTGTTTGACCTTTGCGGATCTGTTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGC
AGTTACCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGCCAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTAGAATATCTGCATC
GACTAAATGTGGCCAGTATACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAAACGTTGGGAGA
CGTGGTTCTGGCCGACAGGCTGACCCTGTTACGACTTTCCGACGCAGACGAGCTCGAGGAAGTGCTGCGGGATGTGGATCGCGCGAAACACCGCCAGAAG
AAGGCGGCAGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTG
AATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTACGTCCAACGATCGAACGGCGAAGACAGGAGACGACTCTCG
ACCGAGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATATCGGGACAGCCCAGGTTAGGTGTTCGCAGTGCGGATCCCGGAAGC
ACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGTAAGAAAGGTCATCCCGGAGATCATTGCTTCTACGTGTGTCGCGGGTGTTGTGA
GATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCC
GAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGA
CCCAGGTAACAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCCGTTGCTAAGGTTTCTAGTTTGCGCAAAGTGGATGAGTTTGCC
AGATCCGAAGT