Description :
From Genome Similarity Track
Location :
Scaffold_584:49- 1639
Transcript NameFunction/comments
Phyra_86276Hypothetical protein

Sequence
1590 bases(100 bases per row)
GCCTCTACCTCTTGCCGGTCGTGTTGAGCTTGGAGCCGACGCTTTCCCGCAGCGAGCTGTAGCCCTCAAACAGGCGGTTCTTGGTGTTCTGGATGAGAGT
CCCCCGCGGGTGAACCTTGTCGAACTTCTTGGTCGTGGCCTTCATGCGCCAGACATGCTCGTCGTCCCAGCGCCAGTCCAGCGCGATGCTGTACATGTCC
TCCTCGACGTAGTACTGCTCCACGGTGGCCATGCCCCAGCGGGTCTTGACCCTCTCCCCCACGACGCTCTTAATCTCCCTGATGATGGTCTCCTCCCTCA
AGTACGCGACGCTCTTGGGCACGAGCTGCACCACGTAGAAGCCGTCCTCTAGACGCACGTCCAACACTGTGCCCGTACCGAAGGTCGTGGCCACGCACAT
GCCGCGGCGGGCCTTGAACGTGGTGTCCGAGCACGGCGACGGGGAGCTGCCACTGCTGCCCGTGGGTGACGTCTTGGCCGTCTCCGCCGGCTCGGGCGCC
GAGTTTTGGCGTACGCTCATGCGGCGGTACAGTGACGTGGCGGTCTGCTCGATGGACATACCGCGGCGGCGGATGGCGGCGGCCGCGACAGATGCAGCGG
ACGGGGCGGGCACCACACCGTCATGGGAGCGGCGCTCGTCGGGGAAGTCCGGCAGCTCCCCGGGCTGGTCGTCGTCCTGGTTGTCGTCCAGCACAGGCTC
CTCCTCGGCCTCCTGCTCTCCCTCCTTGGCGCCCTTCTGCGAGGTGCGGTACGTGGGCACCTTGGGAAGGAAACCGCCGAGCGCGAAGCCCGCGCGCTTG
GGCTTCACGGCGCTGTCTTCCTTGCTGGTCGCGACCATGTCAACTTGTATCGGAGCTCTTCTTCCACTGGACTTTTGCGTTGTGTGCAACTGCGCAGACG
TGTTTAGTGAGTGTACTTAACGAGGAACGGCCGTGGATCTCAAGTAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGAGCGCAAGAAAATGGATT
CACGAGCAAAAGAAGCTGTATTCGTTGGTTATTCTCGTGAGCGAAGAGGCTATCGGTTGCTGGACAGCACGACGAACAAGGCGTTCTACA