Description :
From Genome Similarity Track
Location :
Scaffold_3417:49- 1320
Sequence
1271 bases(100 bases per row)
GGTAGTCGAACTCAGACAACTGATGCCACAATAGGTTATCGTTGTAGCTGAACCGGGCAAGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGACGACACTCGTCGTCGCCGGGGTAAATGGACTGGATTGTCTCCTTCATGTGCATGAGGTCAGGAATTGACTCGAGACATGTGCGATCTGG
ATGCGTCCAAGCTGTGTCCTCGCAGTCTGGACGGCGCGAAAGCGCGTCCGCGAGGGTTCACTCTCCCAGGCTTGTATTCAACTCTGAGATTGAATTCAGA
GGAGAACGCCAGCCATCGCGCCATGCGCTGCGATAGATGGGGAGAGTTGATCGCAGTCCGCAAGGGCGCGTGGTTGGTGAACACGACAAATGGAGCCACA
CCCAGAAGGTGGATTCGGAATTTTAGAAGAGCATACTTGATGGAAAGTAGCTCCTCGTCGTGAACTGGGTAGTTCTTCTCAGCTGCTTTGAGCAGTCTAC
TTTGGTACGATATGACGCGGTTTCGACCGCTGTCATCAACTTGCGTCAGTGCGCTGCCGATGGCAAAGTCGCTCGCATCGCAGACGACACTGAAGGGTTT
CATGTGGTCTGGCAAAGCCAAGACCGGTGTAGAGATGAGCGGCTGCTTCACTTCATTGAGGGAAGCCGCAACCTCGGGTGTCCAGCTCCGCTCGACATCC
TATTTCAAGAGATATGTAAGGGGGCGGACCTTTGCAGCATAGTCATCACTGTACTGGTGCAAATAGTTTACCAAGCCGAGTCGCTTGCGCAAGTCCTTGG
CATTGCGCGGCACTGGCCATTCCGAGATTGACTTGATTTTCTCTGGGTCCGCACGGACACCATCGGCGCTGGCAAAGCAGCCAAGGATCGGATCTCTGCG
GCCTCGAAGACGCACTTCTTCAGGTTGCAATACAGACTGTTCTCCCGCAGGCACTAAAGCATTGCGGTGAGGTGTCACTTGTGCACCTCAGTTGCGCTGA
GATCTCCTTCGGTATGACTGTGCACGAATATTTCGTCAAAATAGCTCGGCGCATACGCGCGATGCGGCCGGAGAAGGTGCGTCACCAGACGATTGAAGGT
CGCTGGTGCATTGCGCAAGCCTTGCCGCATGACGAGCCATTCCCATAGCATTCTGCTGGGTGTGCTGACGGCCGTCAGAGGGATATCCTCCTATCGCATC
AAGATTTGATAAAACCTATCCATCAAACCGAGCGCGGAGAACACACTCGACCCACCCATGGAGTNNNNNNN