Description :
From Genome Similarity Track
Location :
Scaffold_2553:49- 1117
Transcript NameFunction/comments
Phymu_g14188hypothetical protein PHYSODRAFT_335121

Sequence
1068 bases(100 bases per row)
taacaatcacttgacgtgtaaccccgttacaatGAGCTGAACTACAATGTGGCGGAAAAAGAGGTGTTAGCCCTGCTGAAGATCCTAGATCTCTACTACA
ATCTGCTCGTGGGACGCGAAATCAAGGTCCTGACTAGGCATTCTACGTTGGCTTGGCTGTTCAAGTCGGCTGGGTTTAAGGCCGCCTAGGGCAATAGTCG
GCACTTCTGTCGCCATGGACACTCGAGATCACGAAGTGTGCGAAGGGAGAGGATGAAATACTGGGGGTGATCACTGCCAGTATCACGCCTAGATCCGAGA
TCGACGAGGCGTTGACCGCGATCGCACCCAGGAAGGAGCCTAAACGCCGGATCCAAGCACCCATCCCCACGGTGgaccgagatgaagaactgtgGGCAGT
AAGTTTTGACGGATCAGCTCGAGTgaagcgaggtggaggtgcCTTCAGTGCGATCGTGTGGAAATTGCCCGAGTGGAAGGTGATCAAGGCTAGATCGGGG
TATGCCAAGAGTCTCACCTTCAACGAAGCCGAATATAACGGCCTGCTGCTGGGACTCGAACTATTGAGGGGCCTCGATCACCGGCGCCTGGTGATCTGCG
GTGATTCTAACCTCGTGATCAGGCAGGTCCGTGGTGAAATCGACTGTAAAGCACCGGGACTAACGCTATTGAAACAGAAAGTCCTCGACCGCCTGAGAAC
GTGGGGCAATCACGAACTGGTACATGTGAAGAGGGATTGGAATGGGAGTGCTGACAGCCTGGCGAGCGCAGCCTTGCAGCGACAAGACGGGATCGAGATC
CAGAGCGACGCTGACTGCCAGGATCTGATTACCCTGAACCGGTTGGACGAGATCCTAGTACCTAAGAGCGATGATCCAGTGGTGCGGGTATCAGCCGTGG
CTACCGGGCCAACCTCCGCAGAGGATCTGAGGCCACAGTCCTGCGGGAAGATTTGATCAGGGATATGCGGATCGATCGGATTAAGCGAgcgcaagacgaa
gaaatctGGATCGCAGGGATGAAGAAGTATCTGATCGGGCAGATTACGGATCTTACTCAAGCCGAATC