Description :
From Genome Similarity Track
Location :
Scaffold_97:48998- 50152
Transcript NameFunction/comments
Phyke_g4236hypothetical protein PHYSODRAFT_505814

Sequence
1154 bases(100 bases per row)
CTCTACGTTCTGCTGGGAAAGTACTGTGAAAAAGTGGTTCCGCAAGAATTTGGTGTTGCGGAGAAGTGGTATTTTTTTCTGACAAAAACGTACTGGTTTC
CACAAGCGTCCCAGCTAGTGTCAACGGAAACTCTAGTCAACGAGGAGGCTGGAAACATGGCATTGGACGCTGACACAGTGGAACCAGTCCGACATGAACT
GagacagcaagagaagaATGGTCGCGCTGTGTTGATTGCAGGCTTACGGAAGGAGTTTGCAGTCCAGGGAGGAATGAAGATCGCGGTGCATGGCCTACAC
TTGAAATTGTACGAAGGAGAAATCACCTGTCTTTTGGGTCATAATGGCGCGGGTAAAACAACAGTGATGTCTATGCTAACGGGGATGACTCCACCATCCA
GTGGTGACGCCTGGGTCCGAGGTCATTCCGTTGTTACAGGCATGCGTCTAATACGCCGCTCGCTTGGATATTGTCCTCAACACAGTGTCCTATACCCGAC
TTTGACTGTGGAAGAACATCTACTATTTTATGGGCGCATAAAGGGGTTTACTAATGGCAAGAACCTTGCCGACGAGGTGACCAAAAAGATAAACGAAGTC
GGGTTGGCAGATAAACGCGATGTGTGCGCGCATGCGCTCTCAGGTGGGATGCAACGAAAGCTGTCACTCGCCATTGCATTCCTTGGCGACAGCACGGTGG
TGTTTCTGGATGAACCGACTGCGGGAATGGATCCATACAGTCGACGCAGCACGTGGGAGCTAATTCAGCGGAATCGCGCAGGGCGTGTAGTGATCTTGAC
AACTCACTTCATGGACGAAGCCGACATTTTGGGCGACAGGATCGCAATCATGGCGGAAGGAAAGCTTCAATGTGTGGGGTCGTCATTGTTTTTGAAAAAG
CGATTTGGTGTGGGTTATCGTCTAAGCTTCGTGAGGCAGGGTGGCATATTATCCCAATCCATCACCTCATTAGTCCAGCAGTACGTCTCTCAGGCACTCG
TTGCATCCGACATTGGAACTGAGCTCACCTTGCAGTTACCCTTCAAGGCATCTGCTGGTTTCTCGGCACTTTTTCGAGAACTTGAAATCAGACAGCACGA
ACTAGGTGTTCTCTCTTTTGCCATATCCGTGACGACTCTCGAAGAGATTTTCCT