Description :
From Genome Similarity Track
Location :
contig_18:489972- 496267
Transcript NameFunction/comments
g3760.t1hypothetical protein

Sequence
6295 bases(100 bases per row)
AGCTCGGCCGATTGAGAACACGAAGAGGTTGATGAACCACTCGAGTGCGTATTGGTACATCGGGTCGATCACTGTGAGGTCGGCGATGCAGAAGAAAAGC
TGAGACGCTCGGAAGGCCACGGGCAAGTAGCCCTGGCGCTTTTCAGCGATCATCTGCTGCGTCACTGCAGCCTCACGAACCTTCTCCTCGATCTTGTTAG
CCGTGATTTTGGACGCACCGAGCGTCTCGATCAACCGTTCGTCATCCAGAATGTTACCCTTGGCAGTCTGGAGCAGATACAGGATTTGATCTTCGATCTC
TTTCAGTGTCTTCTTGTTAGCTGCATCCTCGAGCACCAACTTCTCCCGCTGCTGCTCCAGCACAGGCTCCTCCTTAGCAACTACGATTCCCAGCATCTGG
TCTTGCAGGCCTTCCTCGGTAGCCATGAAATTCAACAGATTGACCTTCACACAAGTCTCCGGCGGGTAGTGTGGGTTGCGCAGCTTGGTTGTCATGTACA
GGCGGAAGTTGGCGTCGTACTCCACAGTATTGTCACCCAGGCGAATAGTAGCCACCCCACCAGTCTTCACGACTTGCTTCAGTAGAACAGGCTCTAGCAT
CGGGTCGATTTCTTCCGGCATATTCTCGATCAGCACAGCGGCGCCGATCATGATCGAGTTCTCCAGCATGCGCACGAACCCCGCTTGGGACTGCTTAACC
ACTTTGAGATTGTTGCTCTCCTCCATGTTCTTCACCCATCGGTTAGCCTGGCCTTGCGGGTCAATCATTAACGGCCACCGATTGCTACGCTGCAGCATGA
TAGCATTGTCAATCGAGAAGGAATCGTTCGGGAGCTTTGCAATCGTCCACGCGCGGATTTGGACGGCGTCGCCCAGCGTATCCGTGAGTGTAAACGTTTT
CGAGCACGTGATTGCCTGCTTGGTGAGCTCGGTACACCACTGATCCACAGCACGCTCACGGTAAATACTTGTAAACGCGCCAAGGTAGGCGATCACACCG
GAGGCCAGCATGATATCGCCCACGACATTGTCGTACAATCTGCAGTTGGGCAGACATATCACCCCAACGAGCTTTCTCGCCTCCCAGGCCACCGATAAGC
TGCGTAGCTCGCGTAAGTTTCTTGGAGCAGTCATCGACTTGGAACTCGAGGTCGCTCTTCTTCTTGTAAGCAGCAGCCAGGTCCTCTTCCAGCCTGGCCA
CCTTGTCAGCACCACCTGCAGTGCGTCTTGCTTGACTTTGAGCTCGCTTTGAGCCTTCTCAAGTGCTAAAGTAGCTGCCTTAAGTGCTTCACGCTTGGGC
GCCACCACCTTTGCTACTCGATCGTACAACCACCATAGCGTGCACCCAACTACAAAGACCCGAGGCTGCGACAGAGGCCTTACGGATCTTGTCGGCCTGG
AAGTCTGGATTCGCGGCGTATGGACGCACCTTATCCATCGCCTCCACTGGGATGTTGTCCTTGTCGTACTCCAACAAGTTCTGCAGAAAGCGGGTGTCGC
CTAGCAGCGATTTCTGCGCCGGTCCCCAGTAGTCATCCACCTTCTTCGTGCCCCCTGCTGGATCCTTCACCTTCACTGGGGGTACGCGCATCATGATGCA
CACAGCTTCCATCACCAGCTTGACACCATCAGGAGGCTTCTTCATAGCCTTGATCTCGGTGATGTCGCCTTTCGTAAGAGTCTGCAGCGCCTTGACAGCG
TTCTCGAGCGCTGGAATGGCTTCTGCTAGCTCCGCCTCACAGCTTTCCTTGATACCATTGGCCTCAGCTGCTTGTTCGTTACACAGTTTTTCCTCAGCAC
CAACGATGTCTTTCGTAACATTCGCCTCCTTCTGCTCACGTGAAATGGTCTCCAGCAACGCATCAGTCTCGATAGTGGCCACCTTCAAAAGCGGCTGCAG
TGCCTCCAGCTCGATCTGCATCTTCTCCACCTGCTCGGCCGTCTCCATGAGCTTCGTAAGTCCGTTATCATACCGCTGCTTCATAGTCACCTCGACGCGC
TTGTTATTCAGCAGCTTCTTGAACGTGTTGAGCAGCTCGAGATACGAAGTGGGGGTGACGTAGTAGTACCGACGCTGCGACTGTAAGAAGTCCTTCGTAA
GCGCGCTCACACTCTCCTGCATCCCAACGCACACGTCCACGATGCCAACCTTCACCTGAGCCGGCAGTTCAATGTCACCAGAAGTAGTCGGCCACGGAGC
GAAGTGCTTCGTCCGGCCACTCGGCAAACCAATCGATGGTACAGCAATTCACGAGAGACGGGAACATGCGCAGTCGGCGACGGAAAGCCTCTCCAATAGG
CGACAGCGCCAGCACAACATGCAAGTTGGTCCGACAACGACCCACAAAGAAATTGTACAGCTCGGCACTGTTTCCAGCATTAACCCTGAAGCTGTGGCCG
CAGGTTCCAGCGCCTCGTTCATCTGCACCAGTTCGTCATTGGCCCAAAGGTTTGCCACCTCGCCAGTGTTCAACAGTCCGTTGATGTCCTCCAGGTAGGC
CTCTTCCACGATCTGCGTGTCTGAAAACAGGAAGACCGTCGGCTGATTGTTCAGCCCGCTGAGTTGCAGCACCTTCTTGATATCGTTGCGCCATTCGGTT
CTCGAGTACGACTTGGAGATCTCAATCTGAAAGAGTTTGTACTCGGCCATGAACACGGCCAGAGTTGTAAGACTCTTGCGACCAGAGCCGCCGACGCCGA
CAAGCAAGGCATTCCCAGCGGCTGGTGAATCACGCGTGAAATACGCGCAACGTGCTCAATAGCGTTCTGGAACAGCACGAGCCGCATGGGTGCGGCACTC
ATGTTGTTGTAGTCTTCCAGGAACACCTGCATGGCATTCTGCAGCTTTTCGCGGTCACGGAGCTCGGCATAGCTCCTGTTGCCATGTTTGCCGTCACCTG
CTCCACCAAAGTTCCCGTAGATCAGCGTGGGGTTCGGGCCCCGCACATCCGTCGACGTGTATTGCAGGTCGAAGTGCAGCTTCACCGTTTTGGCAAGGAT
GTCGGCAAACCAAGCGCGATCTTTATCGTCGATAAGGCGATCAGAGAACACTCGCAGACATTCGTGACTCCACAGACGCACAAAGTCCTTGCCATCCTTG
ATGGTGTCACTTGACGCCTGCGCGACGCCCTGGAAAACCTTGGACAAGTCGCGCAAGTTGAAAGTGTAGTGACTTGGCCGGAGTGGGCAGCAGAGCCTGC
GAGATCGTGTTGTAAATGTCGATTGTGGCACTAACGACTGCACCTCCGAGCTGCTTGACACCTTGCGAGAAGTTGAGCAAGAACCAGTCGGTGATCCGAG
TGAAGATGGCTCTGAGGGAATCGTTGTCGAACGGCACGAAGTTGATGAGGTTGAAATACCGCACATATCGCTGCGTGATGCGAGTGCGACCACCGCCAGG
GGGGCCCATTGCCGCGATAAACTGGATATCCACGAGCTGCGTGAACGAGTTGTCCTTGCGGTTGTACCAGCCTCCGTGACCCATCCACTGACGCAGGATC
TCGATCGGTGGCTGAGCACCGTACGTCTCTTTGGCAGGCATATTGAGGTCATCAACGAAAACCACGCAGCTTTGACCCAGTGGCGGGCCCAGCACACCCT
TGCGTCGTTTGTCTAGCTTGGCCTCAATCAGATCTTGAGTCTGGTTGGCACTTGTCTGCGCTGAGAAATTGAGGAATATGGACGGCGCAAACTTGGGTGC
TGCGTCACTGGTACCTGGCGGGTCATTCAGCCCGCTCAGTAGCTTCTTCTTGATAGACACGGACTTACCTGTGCCTGTATCACCAGTGCAGAGCACATGG
AAGTGGTGACGTATGAGGGTGTCTAGCAGCCACGCGTTGCGCTCGGAATCAATTGTAGGCACCAAAACTTGCGTGAATTGGGCGTCTCTGGGGATCACGA
ACGACCACCACCTGAAGCTTCCATCCAGTTGACCCAGACACTGCGTCGTGTATCAAAACGGTAGTCGTACACAAGTCCTTCTTCTGGGATCGACAGCATG
GCAGCTCGGTCAGGGAGGAGCACGTACGACGGAGATTTGGCAACGAAGTCTTTGAAGTAGAGTAAGGTGAGACTGGCACCCCCAATTCATCGTCACCCGC
TCCTCGCTTTCCTCCGTACGCACATCGGCAGTGACAATAGCCACTGCTAGCTCAGCTGAGAGGAAGTCGCGCATGTACCGGTCAAAACTGCGGCGCGACT
TGGTGTCGACGCAGGCGCCGATAGACCAAACGACAGCTTTGATGAGCACACACTCTAGAATACGCTGTGCATCGGCCTCAGCGGGCACAGACGAAGAGGA
TGCAGTGGGGGCAGTGCCGTCAGTTGGGGGGTCAGGGAAACCATCGCGGAGAGCGCACTCAAAAAGACGCAGTAGTGAGGCTGCGTGCTCCAGGAAAGTC
ACCGGTGTTGGCACCGTGCAGTGCTTGTCGACAAAGTACAGCATCGGCGGCACAATCCAGCGGAAGGATTCCTCGAGATACTCGCCATGAGACGCGAAAG
CCACAGGCAAACGAGTGTTCAGCCACGTCCGCACAAGAACCTCCCATCCCAGCACCTTTGCCTCGAGGAAAACCATGCCGACACGGGAGACCGTAGCAGG
TGATGCCTCTTCCAGATCTTCCGTCTCGAACACCATCCGCATACGGTCCGTCATCTTGACGATCTCCCCGCTCATGAGGCAAAGCTTCTTGTTGTCGTCT
AGCACGGTGTTCATATTCTCGATCCAGACGGCGTCCACTGGGCCATCGAACATGACCCACTGCAGCTCCGGACTTGTGTCGCGAGCACAATTACGATACG
TGCATGCCAGCACACCATCAGACCACTCGTGCGTGTTTTCATCAAAGTTCCCATAGAGCTGGCCGCTCGTGATAGCCTTCGGATTCATCGTGTGAATATT
CACGCGCTGTTGCAACGTTGCAGCTCCTTTGGTGCCGTTTCCTTCCTGCAGCTCGATTTCTTCTTCGTAACACGATGTCATGGCCGTTGCCAGGGAGTGC
ACCACGCACGTCTTGCCTGAACCAGTCGTACCGACAATCATGAGGCCGTGTCGGACTTGCACCGTCTCGTAGAACTGCACCACCTTCATTTTGAATTCAG
GTTTGCACTCAAGCGGAACGTTCACATCCGGTACGATAGCTATGCCACGCACACAGGTCTCGTCGATATGGCGCAGAAGCGCCCCATGATCTGGAAGTGG
CAGCAGCACGTCGGGGAACAAGTCGGAAGTAATGCCGCGGAAAAGAGGCAAGTCGTCCGTGGTGAACTTGGGAAGATTCACGTCTTGTACAGAGCGCAGC
ACAATCTTGTCCTCCGTCCAGAACGGATCGTTGCCGAGCTGTTGTCGCAACGCACCGGTGGCCACGAGAATGGAGTTAACTGCTCGCATCCCGTAGTCGT
AGTGCTTCTGTGACGATAGCTGCTCCGAAGCTAACTGTAACACCTGTGTGAGCTTGCGAGCGTTGCTCCGAGCCTGAGAGAAACCAAAGGAATACAGTCG
AATTTCAGAGATCAGCGCGTAGTCGGGCACCATCATAGCGCACGGACGGAACAACGCCTTGAGGTTGTCAGGTAGCTCAGCACGCCCTGCATAACCAGGA
TTCATCGTGATGAACACGTTGGCGCTAGCATTGAGCTTGATGAAGGTCCCTTCAAACAGGAATTTGTCCACGCCCGCCTTCTTGCCCTCGTTAATCGTCA
GAATCTGCTGAGCAATGACGGACAGCACCTCGATGTTGATTCGATTGAATTCATCAAAGCAACACCAGGAGCCACAGCCGGCCAACCCCTTGAAGAACTT
TGCCATAGCAAGGTAGTCCAGACCATCGGAGCAGTTAAACACCACGCACTGAATGGCGATCGCTTTACTCAGGTCCTTCACGGTCTCCGTTTTGCCGGTG
CCTGCGGGCCCCTCAGGCGCACCACCATACATCAAATCCACAGCTCCCATCATTGTACGATAACACCTATCTGTAAGCGGTGTGATCACAAGACGCATCG
TGTTTCCGAGATATTCGTATCCGTACCGGACTCGGGCATTCACAATCCGCGCTTGCAAGTCAAACGCACCAGCAGATTTGACACCGTCCGCCCAGTAGTA
CCGTAGCTGAGAGATCCACTCGAAATCCTGGTCGCTTTCCACGTCCTTCTCGATCATGTGAGAGATCGTGTCGCGTGCGTGGACATCAATTACCACCAGC
GCACTAATTGTCGTACGCTCCAGCTTGGTCAGATTGCCGCGTACCAGCATCACAATCTTGTCCAGTTGCGAGTTAAGCACCTCGATGTAAGTTTT