Description :
From Genome Similarity Track
Location :
Scaffold_496:4898- 9584
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.1Pentatricopeptide repeat-containing protein
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.4Sialin

Sequence
4686 bases(100 bases per row)
CTGCCGGCGGACCAGAGCAACTCGTTCTACAACCGGCAAGTGTGCGACGCGTTGAGCCGCAACGACTGGATAACCGCGACGGAGATGCTCAAGCGACTGC
GCGAGCTGCGACCCGGTCAGCCTGTGCTGCTCGCCAAGACGTACGACCAGCTGCTGTTCTTGTACTGTCAGCACCAGCTCGGGCGACGGAACGCGCACCT
CAAGTCCATGCTCGGAGTGCTGGATGAGATGATTGAGCTCAAGCGAGTCACTTCGAGGAGCTTCAACACAGCTCTGGCCGCGTGCAGTCGCTGCCGGGAT
TTACCGACGGCGCGGCGCGTGTTTCAGCAGATGGTTGCGGCGCAGAAGACACCGGGAGTGTTCGCCTACGCCAATCTGATCAACTGCTGCTCTCATGGCC
GCGGAAATGTCACGATGGCTGAGGCGTTCTTCGAGGAAATGGTTCATGAAGGGTTGGAACCGTCCGTGGAAGTGATCAACTCCATGCTGCGCGTCTACTC
TCGATCTCCAGGGAGAGCAGACTCGATGCTAGCGATTGTTGGGCGGGCAATGGAGGAGTTTGCCATGTTCCCTGATGGAGTTTCGACTGAGATCCTTGTC
AAGTATCTGCTTCGATCGGGGGAACTGCAGCGAGCCGTCAATTATCTGAACCAGGTGGCTGGCGCAACAAGTGGACGAAGAACTGACGATGGTGTTTGGA
ATGTCGTGCTGGACGCATGTCGACAGTCTGGCGATTGGGTGCTCGCCGAGCAAGCTAAGGTGCTCATGGAGAAGAGTTATCGGATCGCCAAGCCTGGCAA
GTCTGCAAATAAGGTAACAGTGCAGCTGTTTCAGTTGATTAATGAGCGAGACAACCAATCACCTCCGCTGGCGTGGAAGTCGCCGCTGTTCGATGGCAAC
GAGGTGATTTCGGACCGCGTTCGGCGGAAGGAAGCATTGAAGAACAGCGATACCAGTGCTGGATATGGAGCATCGCTTCGCCTATCAGTTCAAGGGAACG
CAATCAGTGATGCACATGGTTCACTGGAGGCGTCCAAGATGGAGCTGTTGATGCTCGCCAGAACAAATCGTGTTGATGCAGCTGCAGCTTTGTTGGATGA
ACTGTTCTTCAAGGGTCACGCAGACGCCAGCAATTTTGTGGATGTTCTTGCGGCATGTGGTCGTACTGCGCGACTGGAATTGGCAGAGAGTATCCTAAAC
AGATTGAAGCAGTTCTGCAACAAGACTGGCACCCGTCCACCTTTGGCAGCATACAACACTATTCTGAACTGTTGTGCGGTGGAGGGCAATCTGGACAAAG
CGGAGAACTACTTCCACGACCTTTTCGAACAAGGATGCCAACCAGACGTTGTGACGTTGAACACGATGCTCAAGGTCCTGTCGAACAGCTGTGCCGTGTC
TGACAGCAAGTTGAATCGGCCAGTCGAGGCAATGGCGCTGTATACCTTTTGTTGCCGAGATTTCGGCGTTGAGCCGGATGCAATCACTCATTTCACGATT
TTCCGGCTGTTCACGGTCGCACTCGAGCACGAGCCGGAGCTGGTTGTGCTGGACGACACCACGCACGAGCAAATCCTCATGTTCATTAATCGTATCTGCA
GTGAAGCTCCAGCTGATTCCCTGGACACCGGCGTGTTTAACGCTGCCATCGGCTTCTTTGTACTCATTGAAGACATGGACAGTGTAATGTCGACGTTGAA
CGTGATGGCAGAGCGGCACGTGGCGCTCGACGATGATACATCCGCAGTAGTGTTTGCCACAGCGGGACGATCTGGGAATTCAGAAATCGGTCATGCATTT
TTGGACTTCGCGATCGAGAACAATTCGTACGAGCCGAGTGTCGAAGTAATGAATGGCGCTATCCGCTTGTGCGCTTCAACGTTCAATGTCGACGGCGCGC
TGCAACTCTTCCAGAAAATGCAAGTGTCTGGTGTTCTCGTGCCGAACGAAGCCACGTACATCAACATGATTCACGCTTGCGCGCTAGCAAGGAATGTCGG
CGGCGCGTTGGAGTTTGCTAGTGAAATGGCGCAAACATTCGGCAAGTGCACAATGGACGCGTACAACCGCGTCTTGTTGGCATGTGCTCTGAGCGGCCAG
GCAGAGCGAGTTCGAGCGATTCTGCAGCGTGCTACCCATCAAGAGCATTTGATTCCCGACGCTGTATCGTACGACACAGTGTTGAAGGCGTACGTGGCGA
CAGGGTCGGCTCAAGCAGAGCAAGCAAACCGGGAGGAAAGCGCAGACGAAGATGATTTGGACGATGACGATCGTGAAAATGGTTATGAAGGTGAACTGCA
TCAAAGCCTGACCGTCGAACCTATTGGGGATACCATCCTTTCCATTTTGGTCGATATGCAGCAATACGGGATCGCACCAACGAGCGAGATCTGCTCAAGA
GCAGTGTCAGCGTGTGCTGTTCGCAATGACTACCGCGGGGTTGTGGACGTTTACGACGCTTTGTTGGTGATGTTATGCGACAACGACGTCTCCGTTTCCG
AATTATTGGGAGACGACACGCTGTGCGACTACATCCGCGCGTGCCGGGGCTTGAACGATTTCCAGCGATTGATGGAGCTGGAGGACCAGCTTTGCGAGTG
GTACAGCTATAGCAAGGTTCCCGTCTCTTCACGCGTAGTGTTGGAGTTGATGAACGCATTCGACGATGCGGATAATTGGCGCCAGGCTCTGCGACTGCTT
CGAGACATGAGCGCGACGTTCGGCATTGATCCCTCAGTCACGCTGTTCAACCGCGTCATGGAAATGTGCAATGCGGCTGGCGAGTACCAGTCGGTGCAAC
TCATTTTCCTGACCATGTACAACGCGCTCGCGTATCGCGTCGACCCGAACGTCGAGAGCTATATTCAAGCCATTTATGCGGCGGAGCAAGTGGAGAACTG
GACGCAAGCGACCGATCTGTTTGTCGAGATGCAGCAAAAGTGTCCCAAGGACGAGATTCGTCTCACCGATCTACGCAAGATTGCCTTGGGCCGCAACCGC
GAGTTGGTAAACCAAGACAACCCACATCTCTAAGTTCTTGGTCGCGACTTTAGTCGTCCAAGAGCCCGACTTCTTCGTCCCGGTGTTGGTGATGACGCGG
CGATAGCAGCCCAAAATCTGAGCTGGTAGCGCTCAGTGTGGTGGAAGCTGGAGCATACACGACGCCCGAAGTGTAGCTGGCGTTGTAGATCGACTTGTCG
GACGCGTTGCAGTGGAAGAAGATGGCGCCGAAGACGAGCACCGCGGATGCGATTGCGAAGACGAGGTCCCACGAGCCAGAGCTTTCCAGGATCTTCCCCG
TCACGACGTTGCCTATGATACCCGGAATGGTAGCGAACGTGTTGGACACGCCCATGATGTGAGCCGCGTGGTTGGGTCCGATGTCGATCATGTTGACCCA
GTACCCTGCCATCGTGGCGCGGCTCGAAAACAGCGTGAGCGAGAGCAGACCGATAGCAACAGGTGCACTGGTCGCGAACCGCAGCGAGTACAGGAAGAGT
GCAGAGCCGAGGAAGCCGATGCCGTTCATAAGCTGGCGGACGTGCAGCTCGCGGTGGTTGCGCGCCACGAGCAGGTCGCCGATGCGTCCGAAGAGCAGTG
TGCCGACGTACCCGCACATATACGGAAGCGCCGCCGTGACGCCATGCTTGCCGAGATCGATCTTCAGCACTTGGCTGAAGTACTGCGGCACCCAGCCAAG
CAGCACATACCAGCTGTAGTTGTAGCAAATGTGCGCGACGTAGATAGCCCAAGCCGGCCGCGATCCGAGCAGCACGCGCCAGTTCATCTTGTCTGTGTCG
AGCTCAGCCACGTTGCGCTGTCGCCGGTGCGTCTCCGGATCCAGCGTGCGGTTCTTGATAATGAAGTCGCGCTCCTGCGACGAAATGTGGGGGTCGTCCT
CGGGGCGGCTTACCCCCAAGAAGAAGAAGACGACTACCCAGATGAAGCTCAGGACGCCAAAGACAACGAATATGCGCTGCCAGCCGTTGGCTTCGAGGAT
CGCCGGGGACACAATGAGCGCCGTGATGGTGCCCAGGTCCGAACCGCTCGCCACCAGCGACACGAGGCGACTGCGCTCCTGCAGCGGGTACCAGGCGCCG
GCGATCTGGTGCATGCACGGGAACAGGATGCCCTCTCCAAGCCCCATCCCCGCGCGTGTGAAGAAGAGGCACGTGAGGCACTTCGCCACCCCAACCGTCG
ACAGATCCTGCCACGAACGACGAGAGCTCGATGAGCTCAGCAGATTGGACAAAACGAATATAAACAACGGTCACGTACGAAGAGCGTCCAGACGATGACA
CCCGTGAGCAGCACCCACTTGGCACCGAGCTTGGTGGCGAAGAACCCGCCGAGGATCTGCAGTCATCCGTATTAGCGACACCAATCAAGTGTGGCACAAA
CCAAACGCACCGACCTGAGTGCACATGTACCCGTAGAAGAAGGCGGAGAGTACCTCGCCCTGCTCCTGTTTGTTGGAAATGAAGGCCGGCAGCGCGATGC
CCATGTTGGTTCCTGAAGTCCACGATATACACACCCACAAATCAGTTCAGAGTGAGCGCCGAACGAGCGTCTTGGACCCCATGAACGTACGGTCGGCGTA
GCAGATCGTGGTGACCCAGAGGCATAGCCCGGCCGTGAGGAAGCGGCGTCGGCCGCTCGGCGGCGCGGAGAGCGCGTCGACCCCCG