Description :
From Genome Similarity Track
Location :
Scaffold_12:489784- 491937
Transcript NameFunction/comments
Phyra_75404cleft lip and palate transmembrane family protein pu

Sequence
2153 bases(100 bases per row)
GGCTTGGAACCGGATGCGCTCGATGGGATCGAGTCCCCCGAATCCGGTGGTAGCTGAGCCACGACGCCTCCGAGAGCGAGGAGCCATAGCACCACTTTCA
TTGCCGCCGTGACGGTGCGGTCGACTCGATTCTCGGTTTTCTTGCCGTCGTGCTTCCACTTGCTGCGGACCTGGCGACTTGGAGACTGGGAGGTCCACAA
GATATCCGAACCAGTGTCCAAGTCTCCTGCGGCAAACCCAAGAAAGATCGCGTCTGCTCGGGATTCTGTGGTCGAGAGGTCACCGCAATGGGAGTGAACA
GACGCCCACACGGAAATGCGCTCTGCTCTGGTTGTGTCGTGACGGACAGGGGCGCTGAGTGATTTGCGTTCGTCAGGGTGGAGACTGCAGTGACCGCGGA
TGCAATACAGCCCCAAACGTCGTACACGTCCGCGATACAGGACGACCTCGTTTCCATCGGTACCGAAAAGAGCACCACGCAACCGCGAATACCTCGCCAA
ACACGACGACAGGATGTGATCCTTCACCTTGAAATTCACCGAGGGGTGCGGTGCCGGTGGTGTCGCGGAGGAGCCAACAGGAGGGCGAGGGCACCAAGGG
CGAACTCAGCGGTAAGAGAGTATCCATCCCAGAAACAGCATGACCATCCAGAACTCTGTCACGGGTATCGGCATTAACGGCGTCAAAGAGAGCGTTACCA
CGAATAGTTGGCTCAACCACATCAGCTTCTTGAGCATCGGACGCTCGTGACCAACTTCGCTGGACGGCACCACCAGCGGGTGATTGTATGATGACCATTG
GGTCCGACTGCGAGCTCAACGTGCTACCGATGAAGCAGCAGACGGGTTCGTACATGACGCACACCGGAGGTGGCTCCGTTCACGGCTGGTACGGGCAACT
TTGGTCTTGGTGAGTTAGCGATGGTGTCGCTACTCAGCGGGTGGCACACTGGCGAGCAGCACTGATGGGTCTTCTTCCGCTGCTGCAGACACAGGAGCCT
CACAACTGCGACAGCATTAAGTGGTCCTTCATCCGTCCGTGAGCTAAGCGACTGCTACAAACAGTGACAAGAGCCTCACTTCACCCTCGATTTCCGCTAA
GGCACCTGTTGCCTAGCTAACGACGGCTCCGGCACAACAGCCTTAGTGATCAGTTGTTGAGCTGTACTATCGTCAACAAGAGTGCGTCGGGCGGCGCTAC
ATGTTGTACGTGCATTGAGCTCAGTTTCGAGAATTCTCCCCAGCGTGCGCCGCTTTTTATTGAGGTGGTTGGTAGTTTGAGAATCATCCGTCGTGAAGTC
CTCTAGACCGAACGGCGTTATGAGGGTGCAGACTTTATTCAGCGTGGGGCTTGCTAGACGATTGGTCTGTCGTGGGGGCGCCATCGGCGACGTCTCCAAG
CCGCTGGACATCCACGGGGTAGATCCACCGCTGGTACAGATAGATGACGAAGACAATATCGTCGCGGAAGCACGAGATGCGGTGGAGCGTCGGCATCTTA
ATGACGAACGCGAACAAGTCGTCGATGAAAGTGTTGAGTGCGCGGTAGATCAGCAGCCGCCACTGCAGATGTGCCACGGACTTGAGCCTGTAGTTGATGA
CCAGCTGCGGGAGCATGAACACAAAACCCAGCGCATAGACCGTTGTAGTGAGAGACTCGAGCAGCCAGGCGTACCACCCGGCGTGTGCAACATACAGTAG
CGAGTACGCAGCGTAGCCAGCAGCTAGTGGGGCAAGCACGAACAACATGTGCGACGTTGCCAGCGAGTCAGCACGCTGAGTCTCCTCCAGTAGACGCAAA
CTGTGTTTGTCCATCGCTTTCTCCTTGTCAGAGGCCGCATCAGTACCAACGTTGGACTTGATTGCGAGATGGCGACGCTGGGCCCGCCAGACCTTGGTCA
CCTTCCACACAAGCAGCACGACACTGATGAACTGCGGGCCTGTGACGAGAAGCGTCGAATCTTGGTCGACCAGGTACAACAGAACCACCGCCTGTGAGCC
CAACTCAGCTGCCATTGCACGCAGCGATACGCCAACAACATTATCGCCCTTAGACCGCCAGTACGACACGTCATGACGGAACGCCAGCCAGTCAAACAGC
AAATGCAGGAGCGACACGCTCATGGTCACCGCCAGCAGCACTGGGTGCGTGTC