Description :
From Genome Similarity Track
Location :
Scaffold_1501:4897- 8587
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1501-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1501-fgenesh-gene-0.3CDC5 cell division cycle 5

Sequence
3690 bases(100 bases per row)
AAGCTGCGCGAGGAGTGTGACGTGTCGCTCGCGGGAGGGAATGACGCCAGCGGCGGCGGCCTGCTCGACGGCGCGTCGCCGCTCGTCAAGCTCATGAACG
ACATGGAGAGCAACATGACGAGCCTGTCGGCCGACAATTACCTCTTCTCGGACGACGTCGCGACCGCGAACCAAGAGAAGTTTGGCTACGTCTTCGCGCC
CATCACTGAGCCACTGCCTTACAAGCGCTATGAGCCAGTGCCGTCCGAGCTCGCAGGCGACTTGAAGCTCGTGTACAGGACCATGGCGTCTGCGGACGAG
AACGAGATCGGCGCGCTGCTCTGGTCAAAGGCGATCCTGCTGCGCTGCGTGCTGGCGAAGAGCGAGGCGGTTGGCGGAGTGGAACCCGAGGCGCCCGTGG
CAATCGTTGTCCCCGAGAGGATTTGCTCGTGGTTGTTCAGTACAAGTGAGTGGCTGCTGTACCCTTGAATTATTATTGAACCTGCTGTCTTAACATTGTG
ACGTGTATATCTTGCTTGTTCTCAGTGTCAACGCACAGCAGCAGCCACGTCGTGCGTGGCTGCCTGAGCAATTTGTTTATGGTGCTCGACCCCGTGAACA
TGACCACACCCGTGAGTCTAATTTTTTACTTTGAAAAATGGTGGAACTTGGTGGTGCTGATGATCTCTTTGGCTCTGTGCATTGATCCAAATAGGAAGTC
CAAGCAGGCTTGCCGAGCGCGGCGTTCTGCCAGCCGAACGAGGACTACCGTTCATTTTTTGGCGAGAAAATGTCGAGACTCCAGATGGCCTGGCAGCCGA
CGGTTTACGACTTCCTGAACGCGTTCCGCACCTTCGGATTCCAGGACAGTAAGCGCTCGATGAGCACGAAGAGCAAGATTGACGTGACGCCCAAGAGCAA
GAAGCAGGGGACCGCGATCCCCTTCCCGGCGCTCAATATGCAATATGTGCTCATGTACTTGGTGATCTGTCTCCGAGTCAAGTGAGTTAACTGATATGCG
TTGTATGTTTGTGAATAGAGACTAGGTACTAATCCACTGTGTTTATATGCTGTGTGTGATTCAAGGGTTCTCAAACTGGAAGGCTACGACGCGTTCAGCT
TTACGATGTTCTTCCTACGCATGCAGTTCGAGACAAACATGCATCCAGAGATCGTCCAGCTAGCCTCGATATGCATTGAAGAGCTCCTGGACGTTTTTCC
GTCGGTCGAGTGGCGCAGGGATTGGGCACCGTCGCTCGTGCTCCGCATCGCTGGGGTCAATGAAGGGCTCTTTGACTCGGCCACCGGGTGGTTGACCGTC
GCGCGCCGACTCCCACGCACACTTCGAGGCACGCAGCTCACGACAGGGCTGGCGATCTACGTGCTGCAGCACCGTATTGACAAGTCGCCTCAGGAAGGCG
TGAGTGTTTCTATACTCGTCCAACATAACCGGAGTCGCCTCTCAAGTGCTAACTCTGTCTGTGATGATGCCTCTTGTAGTCAAACTCGGAGCGGCCACTC
AAGTTTCCAATCCAGAGCGGCCTCGTGCTAGACATTGTCGCCGGGATTGTCGAGGACCTGACGCTCAAGTACGCGGAGAAGCGGCAGAGCGGCAAGACAG
CCAAGTCGGTGCCGCCCTACGACCTGCTCTGCAAGAAAGTGGCGCTCATGGACCTGGCGCTGCAAGCGTTCCTCAACATTCTCACGCAGAAGGAGATGTC
ACTGCTGCTCAAGAAGCTCGACGCGCTCACGGGCACGCACAAGTCGACCATGTCGGCCAAGTGGCACGAGGTATGAATGTTCTTGCTGAATTATTATGCA
TAAGAGATCGTCCGGTCTAATCCTGTAAATGCTGCTGTTATGATGCCTCCAGCTCAAGACGCTCGTGAGTCTCATGCACCGCAAGTACTCGCTCGAGAAC
CTCCGGATCGGCCGCGACACCTCGCCGTCTGCGAAAATGCTGCTCTTCCCAGACGAAGACGCCAAGTAGGTAGCTCCTCTTTGTGTTGTAAATGGCGTTC
GACTTTAGGAACCAGGAGACAAGAAAGCAAGACACAGGGCAGTGAGAGTGGCTTTCTTAAAGTATGGAACGTGAATTAGTCGCTCAGCTGTACCTAACTT
GCTTTTAATCCACGTGGCTCTCTACTCCTCAGCGAGCGCGGCGAACTTCTTCTGCAGCTGCACTTCCACAAGCTGCTGCGAGTTGACCTCATTTGCGAGG
CGCACGACGCGGCCCTGCAGAGCCACGGCCTCGAGCCCCGCGAGCCCGGCAAAGCACGAGCGCTCGATGAGCGCATTCTGGTACTCAGCCACGAGCGCGC
GCAGCGAGCCGAGCGCCTGCTCCGAGCGGCGCTGGAAACCACCGTTGATCACGCGCACGCGCTCGTCGAGCTTCTGCGCGCGCTTGGCCAGCAGCTGCTC
CGTCTCCTTGAGCTCTTCGAACTCGGCCTCGATCGCGCGGAGGCGGGCTTCCGAGGACTCGGCAAAAACGAGCTCCACGCAGTCGTTGCTCTGGTCCTTT
GGCGCGAGACAGCGGGCTTGCGCGTCCAGCCACGCGGCCTCCAGCGTCAGCGGGCTCGCAGTCTTCCACACACTCTCCTGCGCGTGCAGACTCGCCTCGA
TCTGGACCATATTCCGCGCGTGTTCGAGCTGCGCGTCGGAAAACGCGTCAAGCTGCGGCACTCGACCGACCTGCGAGCTGGCTGTCTTCTTGCGCTTCTT
GCTGCTGCTGTTATCCGCACTCGGGTACTTGGCGATGTCGAACGCGATCAGCGCGACCATCTCGCGCGAGATCTCCTTGAGGCCGCCGTCCACAAGCGCC
TTCTTGACCTTGGTCGGGCGCGGCAACTCCTTCTGCACCGCCTGAGACCGTCGCTTGAGCTCTCGCTCGTGTTCTAATGCGCGCAGCTGCTGCAGACGCT
CCTCCCGGTCGCCCGCGTCCTCTTCGTCCACAGCGTTGCCGTCCTGGGCGTCGCCGTCGTCTTCCTTCACTGGAATGTTGATCTCGTACTCGTTCTGCGG
CGCCGGGAGGCTGCCAAAGCCCTGCTTCAGGTCCTCCAGCATGCGCTTCTGACGCGTTTTCTCGGCTCGCTTGCTGGCGTCCAGGCTATAGAGCTGCTCG
GGGTTGATCCCAAGCTCGTCGCGCAATGGCGTACGAGACGAGGACGACGTCAGCGGGGTCTGGATGGACGACGATGATGGTGTTCTCGACGGCGTCGCGC
CAGCGTAGCCCGTGCCTTCCTGGAGCACGGCGTTCTCGCCACCGAGCAGCGGGGTCGACATCCGGTTCATCGCGAGAATGTTGGCGGCCTCCTGCATGAT
CGTATCGTGGATGTCGCGCGTGCGGGCGGCCGGCGTGGACGTCGAGGCTGTGCGCAGTGGTGTGGCCGTGTAGTCGCCCATGAGCGCGCGCGTCTCGGTC
GACGAGTTCTCGAGCGCCAGGGCGGCCGCGTGGGCCGCGTGCATCCCGAGCTTGGCCAAATCCGAGAGCTCATCGTTCGAGACCACGGGCGCCGGCAGAC
TTAGCGGCTTGCGCTTGATCGCGTTGATCGGGTCGTTCTTCTCGTTGACCGCGGCCACGACCTGCGGCAGGTTCTGCTTCATGAGCCCCTTCTGGCGCTT
GGCGTCCTGCTTGCGCTCCTTCTTCTCCTGCTGGTCGCGGCGCATACCGTCAAGTTTCTCCACCTGGCGCGCGGCTTCCTTGGCGCTCAG