Description :
From Genome Similarity Track
Location :
Scaffold_3:489567- 493342
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01319hypothetical protein

Sequence
3775 bases(100 bases per row)
GTTCACTTGTTTGACTGGACGCTGCTGCTGAACTTGGGGCTGTGTTCGTGATCGGCTCTCTTGCTGGTGGTAGAAGTAATTGTAGTTGAGCTGGGTCACT
ATTTCGTTCACATGAGGCGACGCCCCGTGCTTCTGCATGGCTGTCAGCATAACAACCAGGAAATGCGACTGCCGCTTGAACTCTCTTGAACTTCTTGCCA
ATTCTGACTCAAGGGAGCGGAAATCGGGGTGCTCCAGCAGGCGGACACTCGGCGCTTTGCCAACACGTGGGGTAGCTAATTGATCCGAGTCTTCATCACT
GCAGTAATCGGGAAAGTATTTCTGCATGTTTCGATCTACAGCGCTGACAAATTCATCGACTTGGCGAACAAAGCGCAAAATGTGGTTGAAGGTCGTCAAA
ATGTACTGGATCACAGTCGCGTGCTATAAGCCAAAGCAAATATTCGTGTTAGAGGTACCGGCCACATTTCGGAATCAGCAAAACTACACTGTTCACACCT
TGTCCAGAAGAAAAAAACGGTTTAGTAAGAGATCGAGATACTGCTCGTGAGTTGCGTCCATCTTGGGTATCAACGACAGCAGCGTCAGTACAGATCGATG
TGGTAGACTTAAACAACAAAGTAAATCCCGTACCTCTGCCAAGCTTCGTGACGATTGCAGGATATGGCGATATTTTAACCATCCTGCACTTGCTATCTGT
CGTCGAATATTGTAGAAGTGAATACAACCAGGCTCGATACTTTGTCGAGGATCATATCCTACCTGACTGGTAAGATAACTCAGCAAACTCTTGGTGTAAT
GCAGCATATCAGCGCTTTGAATAAGCAGTTGACGCATGTCCTTTTCGATACTAAAGGGAAAGAATGTGAGTCCCAACAACACAACAGCACTAGTAGAAGC
TGCCGTTTACATACTACGAATAGCTTCGACGATGGCGAAGGCTAGACTTAAACTGCAAGTGATAGAAATATCAGCACGGGTTAGGCAGTCCCAAGCACGT
GATGCTGTTACGGAGCCACGTACCTTGACCAAGGCGGACTCCACAGCCTTCACCTGAACGAGGAAAACGCCAAGTTTAGAGTATTTCTGCATGATCGATG
CGCTGAAAAGTACTCGAAGCGTCTGTTGCGCAGCAAATGTAAAGTGCAAACACTTCATAGTTGCGATATCGATTCTTGCACCACGTGAAGTGCTATCCAA
CAGGCTGAAGTCAACACGGACAGATAGTCGACCACCAATTTGCCTCTGGGAAGATGACAACGAATTGTCCTCGAACACTCCTTGAACCGCACTCTGAAGA
AATGAGTTAATCTTCTCGCTGTCAGCCCATGCGATTGGATTCTCTTGCATGTGAGCAACCAATCTTTCGCTGAAAACGTTGAAAACGTCTTGCTGTCGTA
CGTGAACCACCCAAAATAAGTCATAGCCTTGTGTAAAGCATCTTGTATGCAAATTGCGTACCTGTTCCATGAGAACGAACATCCGGAGAGCTTTTACGTG
CTCCATGTAGTTCAGTTTATCTCGAAAGATATCAGTAATCTCACCATTTAGTTCATGACACTGTACGCATCAGACACAAATGAGCAAGAGTTAAAACACC
ACAAACAGCGACTTTGACGAGCAAGTTCAGAGGTTATCTATGTTACCTTGTTCTCGAGGTGTCTAGTGAGACATCGTTCTAATATCCTGTTGAAAGGCAC
ACACTCCAGTAGTGTTTCCTGCATGGAAAGTGGGTCTTCTTCGGTGTCCCAAGTCTTAGCTTTACAGACCGAAATAATGCCACGATTTCGTCTGTACCCG
ATCGTCTCAAGTTCCATTATTAAAGACTCTTGTAAAGAGAGATCAGGTTGCCCAGGCTTCGTCAGGGGTTCAAATGGTGCGTGTTGCTGTTGCTGCAAAA
ATCGGTTCTTCAGCTGTCGACTCGCCAATGCCTCGTTCATCAAGGGTATTATTAACTCTAGGAATGTCGGCACAAGAGATCGATTGACTTCGAACGGAGC
CAGTGACATCAGTCCATCGCGAAAGCTTCGGTTTCTTTCGCGAATTGGAGAAGCACCAACGCTCATTGACGGAGGAGTAGCGAAAAACGACTCTCCATCC
AGAGGAATCGTCTCAAAATGACCCCTTTCGAAGATCATCCGGCTTATCAAATCCAAGTACGGGTTCAACGCTCCAATAAATAAATGCAACAGTACATCGG
ATCGTGATAAAAGCCCTGAGTCTCTTGCAGCTTCGTCGGCTGTCACACCTTCAACGTATTCAACTTCCATACTGTGGTACAGTGAGTCAAGCACGCACTT
CGCTTGCTCTGCACGCTTCACTTCATGCCAATGACGATCCGAGAGGCCATTAAAGCACCCCACTAATACCCCTTTCAGCCACGAAATCATCTTGAAAATC
TCCTTCAGCCCACCATAAATTCCGATCAAAGTAGGCTGTCGAGGATTAATTCCAGACCACGGACTTGAGTCCTCTTGTAATCCAGTTGTAACGTTGGTCT
GCTGCTCTACGTTACATATTGAGTCCGTCAAGCTTCTTATGACATCGGACAGTGCATTTGCCAAGCCCTCTAGTGTCACACACCGGTGTTGCTCACTTAA
GTCCCATGCTCGACGGATAAACCCAAGGAAATCTCGAAGTATCTGCAGATCAGTCGCTGCATGCATGAAATCCTCCAGTGTATGTTGTAAAACCGAAGGC
GAGATATGTCCGATCGCCGTACTTAATGACTTCCGAGACCGCTCAACAATCTTCGTTTGAAAATCGATACTGAAGATCGAGGGTGAAGGTCTCACTGGCT
GGAATTCAAACAAATACGACTCAACTCCATGCAGCGCCTCAAAAATCATTCTCACCACAGTTTCTTCGTGAATCAGTCTGTTTGCGACGATATTCTTTGC
TGTCACTGTGCTATCTGCGCTTCTGACCACTGCTTCACATAGTAACCACGGTCGCTCCAGCGTAAACGGAACCAGTTTTCTCGTCTCCAGCTCACATGTG
AGTTCCATATCGTCAATCTCCATATCTCGTATACTAACTTCAGGATAATACCGACACAGCATCTCATCTTGCTGCAATTCCTCGCCCGATAATTCCATTC
GTTTCCTCTCCATCCCTTGTCGTGTAGCTTGCTCTGAGCTCTCACTGCTCCCTTCCTGTTGTCTAGAAAATTCATCGTCCTCTAACGCTTCGCACGATCT
CTTGGCATTGCGTTGACGAGTGTCAACACTGCGTTCGCTCTCGACTGCACTTTCATCTGCACTGCTCATGTCCCAGTCGCTCTCGTCCTCGTCACTGTCC
TCCCAGGCCTGGTACCACTCGTCATTGGTGGATATCTGGAAGAGCTCTTCGACTAGTTGGTCCTGCATCATCTTGTGCTGCTGGAGTTTGAGTTGCTCCT
GTTGCAGCACCATATTCCATCTGCTTTTAGAATCTAGATCCACCTCCACTTCTTGGTCCGTAGCGGTCGTCGGGGACGTCGCCAGCTCCAGTAAAAGCTT
TAACACTTGATAGTCGCATTGCGGAGCCAATTCCAGCAATTTGTCAGCTCGTTCTTCAAGAGAATGTACGCGGAACTTTGTGGCGAGCGCTTGGGTTTGA
GCATGGACGTCCTGTGGAAGAGAGTCGACGAATCGATGCGAGTACAGCTTCCCCACGACGCGGTCGGCACGCAGCAACAGTGCCTCCTTTGAGAGCGAAG
ACTGATCTTCTTCGTGGTCCTGGTTACTGCCGCTAATGTGCGCACAGAGCTGCTTGGCGAGCGGCCGCCACTCGC