Description :
From Genome Similarity Track
Location :
Scaffold_139:48951- 51323
Transcript NameFunction/comments
Phyin_T30-4PITG_20373Putative uncharacterized protein

Sequence
2372 bases(100 bases per row)
CGGCACATAGATGCCCGCGCGCAATGACTTGGCCTGACCAAGCCCCCTGGATTCCGCGCGTGAGCCATCCACTTTGCGATGCGCTGCCTGGCTACGCTCG
AAAAGTAAGTCACCACGACTCTTCTGAAGCACATCGCGGCAAATGTCCCCAGCTGGACCTACACGCATCCGTCTCTCGGTGTAGGTGGCCGCTCAAGCGG
ACTGCAGCTCTCGAAAGGGGATCCTGATAAACCTCCACCTCGCTTGTTTAGTTTTCGTTTTTCCGCCATGTTGTCCTCGAGGCGCAGCCGCACCATGTCA
CGGTAGGTTCGACTAACGTTCCCTGACAAGTTGACTCACCCCACGGGCTCCGATAAAACTAACCACGATACCCGCTGTTCACTTCAACAGGAATGACTCG
AAGGCATTTCCGCTGCCTGACGACTTCTTTCCAGACATCAAGCTAACGGAGGAGCAGATCCTGAACCACGAAATGCGGGTCGAGGAAATCGTCCGAAACG
CACTGCTTGAGTACGATCGTCACGAAGCAAAAGGTGCCTACCCAATCTACAGTGCGCCGTGGGTGCCCGTCGGCAGCGAAGGCCCTTTGACTGCTATTCG
AAAGGAGTCGACGGAGGGGCTTACGAACAGCGAGTTCCGTCTCTTCGGATGCATTCAGGGCGACTGGCGCAACTTCATGAATTTTTACTACGCCGAGACA
TCTGAGGAGCTTTTTGAATGGAACCAATTCATGTACGGATATGCAGTGGACGCGGTCGTGCTGAAGAATATTCACACGAGAGACTCGGGAAAGCCACATG
AGTATTTGGGACTCAAGTGGACGTGCCTGCAACCCTCGTCATTTGGCCGCAAGCGCGACAACTGTTTTCTCGAATACCTGACGTACACGAAGGACGAACT
GGGTCGCAGCGTAGGTGTGCGCGTGACGCTGCCGGTCGAGATCGACGAGTGCCCGGATCTGTACCGCAGTCTGAGAGTCAAGCGCATCAAGACACACAAT
GTTGCCATCGTCCGCCCGGCAGGGTCTTCGTCCGAGGCTACACAGCTCTTCGTCATGAGCGAAAACGACTTTGCCGGTTTGTCAGTGAGTGCCAAGAACT
TCAAGAAGTTTATGCGCATCTACAACGACATGGCCCTGTTCGTCGACTCTAAACACATTCTGAAGCAAGGAATGATATGCAAGACGAATTGGATGCCCAA
CAACTCGCGTAAAGCTTGTACAAATTGCCAACTCCCCTTCAACGCTGCCACTCGCCGTCGCTCCCACTGTAGACTGTGCGGAGACATCTTCTGCAACCAC
TGTCTGATTGTTCGCAACGTGCCGCGCGACCAAAACGGAGCACCAAAGTCGCGTACCTTCCAGGTGGTTAAGTCTCGCTTCTGCAAAGCGTGCCTTTCAA
GAGTACGCCGGGAAAGTGACACAGTGCATTTAACTCGGTCGGCAGTGGCGTGTGGATCTTCGGACACGAGCATCAGCAACGGGAACGACGTCAACAATGA
CAGCAAGAAACTGCGTAAAGCTGTGAGCAATACCAGCGACCGAAGCAACTTACGGCAAGAATGGTGGGATGACATCGCATCTGAGTCCGATTGGTCCGAG
ACGGACTCGGAGGATGCCAGCAAGGCCTCTCTAAACGCGTCAGGCCGATCGAGACTTGCTAGTTCACTGTCATCGTCGCAGTCGTCGTGGACAACGACCT
GCCCCGAAGACACCTTGGACGATATGTCGTTTGTTGCTACACTGGATGTTATTGACGACGACGTGGCCATTCTCGACGAGAAACCACAGAGCTCCAAGTC
CAGGCTGCACAAAAAGCTCTCATATTCTGGTCGCTATTCGATGAGTAGGAGGCATTCAACACGCAAACCGCAGTCGCAGCCATCCGTGGAGACGCACGAG
GTCACCGAGGTAATCGACACCACCGACATGATGACGATGTCCGAACTCCGGCGACAGTCACGAGCACGAACCACTGGTGTTGTGGCCCCATCTCGAAAGT
ACAGCAAGCGACGCAGTGGGCGGGAATCATTGTTGCTTAGCTCGAGCGGACCTAGCCGACGTCTGAGCCGTGACGAGCCAGCCAACCGGTTCCGCTCGTC
TCGCTCTATTAGTCAGTGCCTAGCGGAGCAGGAAGAGCTCCTCCGATGTATGCTCAGTGTCAGCCGAGTGCATTCGAACCCTGGCGTGGGCTCCAAGAGA
AGAGTTTCTAAGCCACCTAAGGTGGACTTTGCGGCGACTATGCCCGCTCCGCGCCCCACGGTTCGGTTATATGACCGTTAAATTTGATTCTAGTCTGCAA
GACTGCAGCTTACAGCACTTTATCTATTACTACAGTACTTAGCGCATAATAAAGGAGTAGACTGCGATCGAA