Description :
From Genome Similarity Track
Location :
Scaffold_40:48935- 55119
Transcript NameFunction/comments
Physo_135679hypothetical protein
Physo_157256Prostaglandin-E
Physo_135681VCBS protein

Sequence
6184 bases(100 bases per row)
TATTTTATATCAGGGTGAAGGGGGTCTAAAAATGGCTTGTTTCGTAGTGATATCATTTGGGTCTCGCCATCCAAACGGGACCGCTAGCGAAATCATACTG
ATTTTCTGTTCGGTCTCGTTTAGATGCCGTAGGACCAAAACAGGACCAGACCTGCATAAGACCTGTTTAAAACCTTACCAGTAAAACCGATCTGGGAAAG
GAAATGTACGCAATGTGTTGGGCTGATCGAAAGCCCAAGACAATCATTTCTAACCGCGGCACAACTTTGCCTGGAAGCGACTCCGTACGCCCACGACATC
GCCTAATAGAACGAGAAGGGATTGTTGAGACTCTTCGCTACGAAAAGCGGGTCAAGCGCCCTCAGATGATGGCATTGTTCTTCTCGAAGTTCTCAACAAT
CGACGTTGACGACCACTACCGTCAAGGCAGCCTTGCGCTCGAGCGACAATGGCTTACGCGCAATTGGACTCACCGATTCTTCAGTACACTGCTTGGTATG
ATTGTAGTTGATGCCTTTCTAGCCTACCGCTACGATATGCGCGACGAGGATCCGGGTAATTTCCACGACTTCGTTTCGCAGCTAGCGTACCAACTGATAT
TCAACAGCCACCCGACAAACAGAACTCGACGAAGCGGAGGAAGTGGTGTGGAGTACAACAACGAGCTTTCTCACAAAATCAAAGCTCTAATTGACTTACC
CCAGTATGCTCGAGCGCGGTCCGAAGGTAAGAGGGCCCAACGTTTGTGCAAAGTTTGCAACAAGAAGGCTTCGTACTACTGTGAAAGCTGCTCTGACGTC
GAACGAGGCGCATTCTTCAGCATTAGCGGCGCTGGAGCGACCAGGAACTGCCTCAGCGCGCACCTGACGGCAACACTAGGATGAACTATCCATGCACACC
ATATGATTTTCCCATACAAACTCTTATATAAATCTATCTAGCTCCATAATACCGGTAGGATTTGGGCAGTCTACGGGTAGGATTTTCACCGGGATAAAGA
TTAAAAAGTGCGAATTTTTACCGGTATTTCTTATGACGGGCTTCTATTCGGGAAGGGACTTATATTCGGGCGAGTACGTTAGTTTTTAGTTCGCCCCCAA
GATTCGTATCAATATGGATGTCGAAGCCGAGAACGCCCGCTTGAGGGAGGCGCTGCGCGCGCTGCAGGAGCGCTACGATCACCTCGATGCGTCCACCACC
AAGCAGATCCAAGACTTGACGGACGAGAACGAGCTGCTGGCCGAAGCCAACCGCCTGCTGCTCGAGAAGCAGGAGCAAAGCCCCGCGACCGCGACCGCCG
ACCCTATAAGTCTGCTCCAAGTGCCCGACGAGCTGCTGCTGCCCGGCCCAGAGCTGGCAATCCGCCCGCTAGCGGCTCTAGACAACGTGCACGCGTTCGG
CAACTTGCTGAGCGTCAGCGCGCACGCCACGAGGCCCGAGATCGTCATCAGCGGAGGCGCGGACAAGTGCATCTGCGTGCACGACTGGAAGACGGGCAGG
AAGCTCTGCGCTGTGGCCACCAGCGCGCCCGTGCTGGAGCTGGCCTTTAACCCAAGGAGGGACTACGCCGACTGCTTTGTGGGGGCGGGCATGGACGCGA
AGCACGCGCTGTACAGGCTCGTGGAGGACGGGGACGAGTGGCGAGTGGACACTCTCTGCGAGTTCAGCGACCACACGAGGCAAGGAGCCTTCAAGGTGGC
GTGGAGCGCGTCGGGGCTGCTCTTCGCCACGGGGTCGAGCGACAAGTCGCTCAATATCTACCAGTGCTCGCAGCTGGAGGACGGAGCGAACGTGCAGTGT
GAGAAGATCAAGTCCTTCTACTTCAACGGGACGGTCGAGGCAATTGTGTTCGCCCCAGAGTCGAGTCAGGAGGAGAGGGATCGTGAGTTGTTGGTGATCG
CGGTCCGAGACGACTGCTACGTCCATTATGTCGACTGCTCCACGTTCGAGAAGGAGAGGTACGAAGTTGAGGGGGAGAGTGAGGTGGCAAGGGCTGGTGT
GGATTAACCATGTTGATCGTTGTTATTGTTTTGCTACTGCAGAGTCAACATGAACCCGGACGGCATCGAGCACGTTTCGTACACGATCATGGACCTGAGT
CTGTCTCCGAGTGGTAAATACCTGCTGGCGGCCACGGACTCCAACCGAAACTTCATCTTTTCTGTAAGCTGCTGGTGTTTGAAGTTTAATTCCCTGCGAT
GAACTAACGCGCTCCAATAACTTGTGGCATAGATTAAACGGAACGTGGCGCTGAGGAATTTTTACGGACACAAGGCTGGCCCGTACAGCCAGCCGCGTGC
TGCCTGGCACCCGTCAGAGAAGTACGTCATCTCCAACAACGAAGACAGTGGCGCCATCTTTGTGTGGTCCGTCGCGTCGGAGCGAGTTGCCGAGACACTT
GATGCTCACGAGGCGCTAGTCCGAGACCTGGTCTGTCCGGCCACCACGGTATCCTCTTCCGGCTCACCAATGCTGGTTACCGTGTCCTACGACAAGCGCA
TGAAGGTGTGGGAGTCGCCGCTCGCAAAATCAGGCGCCGAAGTGTTGTAAGTACGGACTGTAGAATGAGTTTCTGCTTGTTATGAGGTGTTAATCTGCGC
GAATACCTCCTTAAGATCTCGGATCTCCTGCAAAGTGGCCATCGTCGTGGCTTCCCACTGGTCCAGTTTGGCTTGAATGATGCTGACCATGCTCTCTTTC
CCTTGAAGCTCCTGCTTGAGAGTCTCAGCGTCGACGCGTTGCTCCAGTGGAGATTGAATTCGTTGTCGAGCTGCCTCTTGCCCCGGAATCTTCTTGCGAT
TGCTGGCAATGCTTCCCGCTAGAGGTCGTGAACCAGTCCCGGAGGCTGTCCTAGGTGGACTTCCTGAGTCCCCACCGCCGCTCTCGCCTTGAAGATTGGA
CTGTGAAGAGGAGTTGTCAAGGCGCGGTCGTGAAGGCTTCGCGCGTCCATAGTCCACCTCAGGTTCTGCTCACGACAATGTTGTAAGAGCGACAGGTTCA
AGTATTCCACGGAGTTATGCGGCACTCACCTTTCTTGTTTCGAGGTGCAGCTCCGTCGGCGACCTTCTTGGCGACGCTGTCAGCTGTGCAGCTCTTGTTG
TGGATCGCAAGTCGGCCTTCAGCAAACGTCCTCCCACAAAACTCGCACGTCTCCATGCCATGGACGTTGTAAGCTTCTTGAGCGGCTTGGTTGAGAGCCT
CGATCTCTTGACGAGTCATCCCACCACCGCCTTCACCGATTCCAGGCGGGGTCTTCGGGATCGGACGGCGCTCATTCTTCGGTTTGAGCTCTTCCTGAAA
ATGAACGACACCCTAGTGAGAAGTCGTACACATTACATGTACTTCTTCTCTAGAAGCTCATACCGTCTGGACCCAGAGTTTCTTGCACTGCTTTAGATGT
ATCTCGAACGAAGACAAACCGTACTGGCGTCCACAAACATGGCACAAACGGGTGACAGGCCCAGCCTTCAAACCTGCACAGGAGAAGAGTCGTGGTGAGC
TTTAAGGGCAAGTTGTCAATGCAAAGGGCACTGTGTGCTTCCTACCTGTTGCCATAGCCGCGAAGAAGAAGAATAAAAGTGATGCGGCGGTTGAAAACTA
CATTTAATATTAGGCCGTTTCTTGTTGGTTAATTGTCCGTTGCACGCATACCATTCCCTCCTAAATGAGTGGGTAATCCCATACATCCCCATCGTCTTCA
TCACTGCCGTCAGCGGCGGCTTTCTTGTTGTTCGAGCGCTCAACAAGGTCTTTGTGGCGACTGCCCACCTCGAAACACCACAGCAGTCGCTTTAGCGGAG
CGTATTGCTCCATCACCGCGTAGTGGCGCAAAGTTGACAACCCAGTCGCTTCCTTTTCGTCGGAGAATTTTGTAGCGTTTTCCACGATACTTTCTTCATG
AAGTTGGCGAAGCTCGCTCTCGCTAAACCTCTCGAGCTTGTTCACAAAGTTTGTTCGCTGTGGCTCGGTGAGCGCTGGGAAACCGGCAAACCGCTTAGCG
TCCTGTAGCAGGAAGCGAGATCGTGAGTTTTTGCGTTCTACTTTTTTCGAGTACTGGCAACGTATATCGCACCTTCTGCACCGCGTTGAGTAGTGCATTA
ACCGCTAGGAGCTCCTTGGCCCTGTTCACGTATTTTTCATACTTCGAGGCTGGGTTTAAGATAACTTCCGTGATTTTGTGGTTCAGCGCCAAACTTTTCA
CGAGACTTCGGTATCCAAGCGATCGAATGTCTGGGTTATCGGTGATACTGGGAGGAATACAATGCAGTCAAGAGTTAGGGATATTTTTTTCATCATTTGT
GACGGGGTTGAACGTACTTGAGCGTTCGAAGGGTGCTGTTGAATTTCCTCAGCACCGTTGCAATCTCGCTCATACCTTCGCAGCTGATCTGACACTCTGT
CAGACTGCACAGATTAAGATCGATAAGATAAAAACATGGAAACCAGCAAAACATATTTCCAAGACGTACTCGAGTGTCAACAGAGTTGCGTTCTTCCTGA
GAGCAGTCGACATGTCCACAGCTCCAGCATCTCCCAGCGGGTTATGCGCAAGTGTCAATGACACAATCGTGCAGTTCACCTTTAGCATTTCTGCAATGTG
CACGGAGCACAGGTAGTCCAAATAGTTGCCCGCCAAGCTAAACAAGAGAAAGATGAGTTGAATATATCGTAATCAATGTGTACTGTAGAGCCACCGAGCA
AACCTGAGTTCACGGAGTGTTTTTACTCGCCACAGCGCGTTACACAGTGATTCCAATCCAGAGAGACGCTTTTCGTCCGTGCTGTTGTGCACCAATCGGT
TCCGACTGAGATCGAGCTTTTCCAGCAGCGGAAAGTCATGAATTACGTTGGCAAACGCCACTAACCCGTCCGATCGCAGGTTTGCAGCGCCAAAACTGCA
CAAAATATAAGACACATCTATCAGTAAGCACAATACCAGCGCAAGCGAATTCATAAGATCCGTCTTACTTGAGCTCCGTAAGCTGCCGACAGCTCTTCAG
ATACTCAAATATGGTCGTGGTGCCATGGAAAACATTCGCTTTCGGCCCGGTCAGTGAATTCCCCGACAAATCCACTTTGTGGATTTTCTTGTGCTCTCGC
TCAATGAGAACGCCGATCGCTGCGGCGTCCAGGTGATTAAAGCCATGTCCGGAGAGATCCACGCTCCCTTTATCTGCAGCCTGAGCTCGAATGCTCTCAA
CTGGGATGGGGGAGTCCGAGAACTGCAGCGTTTGCAGCGTGCTATTCGTCGCCTTTGCAATGTCGATAGCTGCTTGAACGCCCAGCGACGTGCGCGACAG
GTTAAGCGCCACCAACCTGCACGTCTTGGAGCGCAGGTACGGCACCAAGAGCTCCACGAACTCGTCGAAGATGAGGAACCCGGAGAGGTCGAGCACCGTC
TTCCCACCGCTTGCAATGTCTCGCACGCGCTGCACGATGACGTCTCCCTGCGAGCTCTTGAAGTTGCCCTTGCGGTGCAGCACCTTGACCTCGAACAGCA
GCCGCTGGTACGCGTCCGTGATGGAGCGGCGCGTCTCCTCTTCCAGCAGCACGTCCAGGTCGGGAGGCACATCGCTCGGCTTCTCCCGACGCAGCCCTTC
CGCCGCTCGAGGGTCCACCGACTCAAAGTGCCGCAGCAACTCGCACCCAGCCGTGCCCCGCACCTTCACCTTCGCTCGAGCCTCCATCGTAAGCAGCTCA
CTGATAATGCTATAATTGGCTGACCACTTCAACACGTACACCAGCTCTACACATACATTTACCATACAATGTATACCATACTGAAATCCAGTGCTCAAAA
TGGCTACATTTCAGCGGATCCCTTGATCTTGAAGCGACACATGATGGGGGCTCTGCTGCTGTATCTGCACCTCTGCCTGCTCCCGCTACTGCTGCTCTTC
TCCTCCCCAGTGCACGCAATTGAAGCGACCCCCCAAGCTGCCGATGCCGACGCCGTGGTCAAAGCCGACACCTCCATAGCCATTCGGCTGGACGCCAACC
TGTACATCCCGGACGGCGGGGAGCTGCTCATGAGCATCCAAGTGCCCCACGAGCCCATCCAGATCGTGCCCAAGGGCCCCGCGAAGGTCGCTCGAGTGTA
CTCCGACCACGCAGACGGCAAGTTCGGCGTCGGGGAGGTGATCAACATCTTCGTGCAGTTCACGAGCCCCGTCAAGCTTTCGGG