Description :
From Genome Similarity Track
Location :
Scaffold_25:489343- 491009
Sequence
1666 bases(100 bases per row)
GCGGACAAGAGTCTACCGGTACGACGCGATGCATGCAATGACACGACGAAGGCGATATGTAGGTGGTGTCGCCGGACGAGCTCACGATCGCGTCGACGTT
CAACACGCAGCGCGTGCCCGTGAACCAGACCCGCATGGAGTTTGTCGACTTCAAGCAACTGTCGTCCGCGCTCAAGCGGCTCGCGATGCACTGCGGCTTT
GAGATCCGCGTCAAGTACTCGTCCAAGCGTAACAAGCGCTGGGAGTGCCGCGAGCCCGGTACACGATCCTGTCAACGTGCCAAGCTCATCCCGTCATCGT
CGTAGGCTGCACGTTCATTTTAAGTGGGTACAAGAACAAGGACGACCGAGTCCACGTCACCGACATTGAACTATCGCACAACCACGCGGGCGTGGCGTCG
GCGGCCGAGACCGTCGACGCGCACGACTCGGAAGGCACTGGCGACGAGCATGCAGGCGAGACGCGACCGCACGAGTCGCGGCTTACGCGCAACACAACGC
TCTCGAACGAGCTCGTGCTTGCCGGTGTCTTTGACTCGGAAGTCGGGCAGCTGATCATTCTCAAGGACCCGGAAGAACTCAAACTCAAAGACATCCAGGG
CATCTTACTGACCCAGTTTGGGTCCCAAATCTCGGCGTCCATGGCGTCCCGCGCCAAGCGCAAGCTCGTCGAAATGTTCTACGAGACGTCCAACTTGAGC
TACCAGCAGCTGCGGCCGTTCTTCGAGAAGGTCGTGACCGCCAACCCCGGCAGCTTTTACGTCATGGACCACGTGCCCAACCCGCACGACGGTACTTCTT
ACCTCGTCTCTCAAATACCGAACTACCTCTTTGTAGGCTCGGGCGTCTACGAGTACGGCCGGTGCCTCCTCGGCATTGGTGCGGCCATCCGACTCCTCAA
GGACTGTGCGCCCGTCCTCGCCCTCGAGGCGTGTGCCATGAACGCCGTACGCTTCGTTAGCGATTGCAATTTTGCATCCGGAATGCGTAGGAGATGCACA
AGTCGGGGGTCCTCCTCGTCCTGAGCACGCGCGACTACAACGGCGACGTCATCTACCTCGCGCTCGCCCACGTGCCGCTGGACGACTATGTCAACTGGGT
CTGGTTCCTCGAGCGGCTTAAAGCCAACGGGGTGCCGACGATCGCCAACGTCACGTGCTTCGTCTCGAACGGCGCGCCCGACATTGCGCGCGCCGTGAGC
CACGTTTTTCCCGCGCAGCCGCACCGGTTCGTCATCGAGCACATGATCCCGCTCATCGCGGCCGCGTCGCCGTCGCTCAACCGTCTCGGGCCCGAGGTCG
AGCACCTCATCAAGCAAATGGCCGCCAGCACCAACATGGTATCGTCTCGATCGACGAGCGTAGGCTGGACGGTTGCGGTGTAGGACCAGTACATGGACTC
GTTCCAGCTGCTGTGGCGGATCGACAAGGGTAGAGTGCGCCTCATCAACGCGTCGACACTGTACTGCTGTGTAGATCTTGGACGGTACCTCGAGGGTATC
CCAAAGGAGCATTGGGTCGTGGCTGCGATCCTCAACCGCGGGTGGCCGCTGCTCAACGAAGTCGTGCTCGTGCACTGCGTCGGCGAGTTTGGCACGAGTC
CGCTCGGGTCGCTCCTCCGGTCGTGCAACCTCGCGCCGTGCTTTTACCTCTTCCTCCTCTCGATCC