Description :
From Genome Similarity Track
Location :
Scaffold_132:48908- 51174
Transcript NameFunction/comments
Physo_143211reverse transcriptase

Sequence
2266 bases(100 bases per row)
AGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTGAATGTGCGGAGCGGATCGGCGATCCTGAAGGACCCA
TCGGATGCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCG
ATTTCGTTCCGGGAACGAAGTACTGCGTGACGAAGCAGTGGCCCTTACCGAATGAGCCGTGTGGCATCATTGACGCGTTCTTCCGTACGAAGCACGAGGC
GGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCTGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTG
AATACCGCTATCATTCCGGCACAGACACCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCG
ATGGATATTACCAATTGCTCATGCAGACGAGCGACATTCCTCTCACTGCGGTGAGTAGCCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATGCCCCAAGG
GCTTTCAAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCAGGCGTACGCGCAAACGTACTTCGATGACATCTTTGTCCAC
AGTCGTGCTGAGCACGGAAATACTGATATGGAGAAGCATGTGGAGCACCTGCGTGCTGTGCTCAAATGCGTGCGTCAAAACAAGTTGTACGCCAACATTG
ACAAATGCACCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACT
GGCCGGTTCCCAAGAACCAAAGGGATCTTCGCAAGTGGCTTGGCTTAGCCAATTACTTGCACAAGTACAGTGAGAACTACGCTGAGATGGCTCGGCGACT
TTCCAACCTCCTGAAGAAGGATGCGGAGTGGTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGCCTATTCTG
GCTTTGCCAGACCCCCCTCGTCCGTTTTGTGTCGTCTGTGACGCCTCGGACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGGCGCGAGC
GCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTACGGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAATGAAGTATGCGCTCGTCAAGTT
CAGGGTGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTGTC
CTTCTTCGCGGAGTACAACTTCGTGATGACGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGTGCTGTCGCGCAGACCGGATTATGAGCTGGCTCAT
GTAACGACCGTGACTTCGGCATTACTGGATCTGATCCGAACGGCTTATACCAAGGACAACACTTGTGTCGCGTTGCTAAAGGTTCTGGGGAGCAAGGAGT
TTCAAGACTCGGACATGGAATTGTCAGCGCGGCTGTGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAGGA
TACGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGAGGCACATGACGCGCCGCTGGCCGGTCATCTTGGCCGTGAGAAG
ACCTACAGCTCGGTGAGCACCCGCTACTGGTGGCCGAAGCTGTACTAGTGGACGAGCACTTATGTGCGCGCGTGCGAGACGTGTCAGCGCGTGAAGTCGT
CACCTCATGCTGCAGCCCCGTTGGCGAGTTTGTCTGTCCCTTCGGGCTGTAGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGTGGACGCACT
GGAGTCGTGGTCTTCGTGGACCGACGGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACGATCGATGGTAAGGGTACAACGACGCTGTTCTTGGACC
GAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCACGCTTCACGGGCAACTTCTGGAACGCGGTCTTTGCGGTGCTTGGCAC
CAAGCTGGACATGCCCACGGTGGACCATCCGCAGACCGATGGTCAGACAGAGCGCGTGAATCGCGT