Description :
From Genome Similarity Track
Location :
Scaffold_11:489020- 491047
Sequence
2027 bases(100 bases per row)
ACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGAATTGCCGCAGGATAGAGGCATTCGTCACGAGATAGATGT
ACTTCCGGGAACAAAGTACTGTATCACAAGGCAATGGCCGCTACCGAAGGAACAAGTCGATGCGATCGATGAGTTCTTCGCGCAGCGACAGAAGGCTGGC
CATGTGCGCGAGAGCAAGTCTCCGCACTGTAGTCCCACCTTTTGTGTTAAAAAGGCCACAGGCGGTTGGCGCATTGTTCATGCATTCAACAAATTGAATG
ATGCGACCATACCTGCTCAGACTCCAGTTCCACGAAAGGATATGATCCTTGATGTAATGGTTGGCAGCACTGTCTTTAGCGCGATCGATCTGAAAGATGG
ATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAGTGGATGGTGATGCCACAAGGTCTG
AAGAACGCACCAGCAACTTTCAACAGAATGGTCGCGAATGTACTTCGTCCATTAAGAGAGTTTGCACCGAGCTACTTTGACGACATATTCGTTCACAGCA
AGGCCTCGGAAGGGAAGAAAGATGTCGATGTTCATCTTGGACATCTTCGTCAAGTCTTTCAAGTTATGCGTGAGAACAAACTGTACGCTAACTTGAAGAA
ATACATCTTCTTCGCCCCCGAGATCCCTGTACTCGGTTGCTTTGTTGGCAAGAATGGCGTTCGGGTCGATCCTGAGAAGGTCAAGTCTATTGACGATTGG
CCTATTCCTCAGAAGTCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAACTACGCAGCGTTAGTGCAACCCCTCAC
GAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACATCAGGCAGCGTTTGCCGAAGTAAAGAAGAGCTTAAGAGAAGCTCCTGTCCTAGCT
CTCGCAGACCATGAGAAGCCGTTCCATGTAGTCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGCAACACGATGATGAGGGCAAAGAAAGAG
TTGTATCGTATCAGTCACGACAACTCAGGCCCGCCGAAAGGAACTATCCAGTCCACGACAAGGAACTATTGGCCATGAAATATGCATTGGCAAAGTTTCG
AGTCTATTTGCTCGGTGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAGCTGTAAAGACGCCTCACCTATCGCAAAGAATGGCAAGA
TGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTGCATTATAAGCCCGGCAAGTCAAACATTCTTGCCGATGCACTGTCAAGACGTCCGGATTATGATC
CGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACGATTGCTACGGGAGTGACAAGCACAATCCAAGAAGAAATTAC
TGAGGGCTACAAGCAAGACGAAGCATGCCAAGAACTGATCAAGTATTTCAAGAATCCTTCAGACAAGGCACTCCAGAACCTCTCATCAAGAGCAAGATCG
CGTGTTCACCGTTACAGCATGCACAATGAGCTGTTGTATTATGCGGTTGACGAAGGGGATCCAGCGAGGATCGTTGTCCCCAACGATGAAGGTCTGCGTC
ATCGACTCTTGTACGAGTATCATGACAGTCCTTCGAGTGGCCATCTCGGACGCGAGAAAACGTTTCTCAACTTGTCGCGAGATTACTACTGGCCTCACAT
GTACAAGTGGGTTCGCAAGTATGTGCGTACTTGCGAAGTGTGCCAAAGAGTTAAGCCATCTGGCTCAACTCAGGCCCCACTTCGTTCATTACCTTCCCTC
AGGACAGCTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCAAGGGACAAACACGGCAGAATGGCATCCTGGTGTTTGTGGACCGATTTAGTAAG
ATGGTGCATCTTACTCCGGTGTCAGAC