Description :
From Genome Similarity Track
Location :
Scaffold_2:48900- 50211
Transcript NameFunction/comments
Physo_488504taurine dioxygenase, putative

Sequence
1311 bases(100 bases per row)
CTCGAAGTACGGGATCTCGCCGTGCGGCGTCACACGAACAGCGTGGCGGTTGCCCGGGAGGTAGTCGTACGTGGCGTAGTGAACCGTGGCGCGGTTGTCC
CAGATGGCCACCGCGTCCTTCGTCCAGTGGTAGCGCACCTGGAACTCCTGTCCCTGAGCAATGTGCCGGAGTAGAAAGCGCAAGACCGCATCTGAAGGGG
AAAAAGTAGGGGCAAATTAGTACAAGGTGTCACTCCAGCAGACTCATCTTGTGACGTACCAGACTCAGCTGCCGACAAGGTGTTGATACGTGTCGTGAAC
TGGGCGTTGACGTACAACGCTTTGCGACCGGTGACGGGGTGGATGCGAACAACGGGGTGCTCGAACTCGACAATCGGCCGGCGCAGAGTCTGACCGTTGG
CGATTGCGCTTTCCGCTTGGTGCTGCGTGAAAATCAAATTTGGGAGTTAGACCACGACAGTCGATCCAAAAGACGAGAACAGAAGAACAAACCTTGCTAC
TGTGGATGGCAGTGAGGCCTTCGACGAACTTCTTGAACTGAGGAGTGAGACGTTCATACGCCTCGTACGCTGAAGCCCACAAAGTGTCACCGCCAGTGGG
CGGGGTCGTCAGCACCTTGAAGCTCGTGTACGACGGTGGCTAACAATAGTCGAAAGTTAGTATTCTACGTACAACTCATGCCGAATGATTTTCCTTACCT
GACGCTCATAGGACACGTCACTGTGCCACAAATTCACAGGCTCTAGAGCCTGCGACTTGATGCGCGTCGCACTGCCCTCGAGAGAGTTTTCAACGACGTG
CACTTGGGGGATTCCCTTCGCGTGCGCCACCGTCTGATGCACGTGCAGTGGGCCGTAGTAGCGTCCCAGCGCCAACTGCTCCTCAATGGAGATCTTCTGG
TCGCGGAAGAACACCACGCCGCGCTGCGCCACCAGCAGCGCTAGCTCGTCCTTCTGAGCGTCCGTCAGCTCGTGTAGCTGCAGGCCCGAGACCTCCGTGC
CGATCTTCGGCTCCAGGTGCGTCACCGTTGCGTCGGCCAGCAGGTTCTTGAACGTCGGGTCAGCCTTGAGCGCGCGGTCCTCGTACGGGAGCACGGGGAT
CGGGTCGTAGGTCTTGGTGGGGAACTCACCACGCAGCTCCGGGTGGGTGAAAGGAGCGTGCTTGACCTCGAGGTTAAGAGCGTTCTTGATGGGGACGGGC
GAGGAGGCCCCCGCAGTGGTGGGGGCGGAGGCGGAGGTGGAGTCGTTGTTCTTGGGAACCATGGCGCTTGGGCTGCGAATTGGAAAGTGAGCTGCTATAT
GGCACTGCTGC