Description :
From Genome Similarity Track
Location :
Scaffold_3139:489- 1510
Transcript NameFunction/comments
Phyta_totarag15096hypothetical protein PHYSODRAFT_247331

Sequence
1021 bases(100 bases per row)
TAGCTGATAGCTggtctcgttgaagctgggAACGAGTAAGTCGTGAAACTCCTTCGTCTCTGGCTTGAGATCAGGTCGTCGACTAAGAGCATCAGCGATA
CCGTTCTTGTCTCCGGGGAGATACGCAAATACGGGCTGATACTCGGTCAGGATATCATACCAACGAGCTAGACGACGATTTgccatcttctgctgaaAGA
TACCTTCGAGAGACTTGTGGTCCGTCTCGATCATGACTGGTTGATCCAAGCAATAGATCCGGAAAGCTACTAACGCATTGACAATTGCCAgtagctcttg
ctgctgcgtgggaTACTTCAGCTCTGCTGACTTCATCTTCAGACTTGTGAATTCAATCGGTCGCTCGACACCGTCAACAGCTTGGAACAAAACACCACCA
ACGGCAAACTGACTTGCATCCGTTCGCAAGTGCATCTGCTGTGTGAAGTCGGGCAAATGTAGCACAGGGGCATTTGCCAGTCgacgcttgagctccttga
agttcttgagctgcgcaGGACTCAACGTAATCTTCGAATTGTGtcggttcttcttcttcaacagtGTGAACAGTGGTGCTGTCAGCTCAGCGTACTGCTC
ACAGAACCGTTGCACGTATCCTGTCAAACCGAGAAAGCTGTGAAGCTGTTCTTGCGTTCGCGGGACAGGCCAGTCTCGAATCGTCTGCACCTTGTCGGGA
TCGATGCGAACTCCATCCCGGCCGATGAAATCACCAAGGCACGGGATTTCCTCAGCGCAGAATACACACTTGGACAACTTAACGTACAgtttgttcttct
tcagaaTTTCCAACACGTCCCGTCGAGCTCGCAGATGTTCGTTGATGTCCTTCGACTTCGTAAACACATAGATATCGTCATAGAACGATCGCGTGTGTGG
CAGACCCTTGAACAACGATGATGTCAAACGAtgcatcgtcgtcggcgcgTTGCTGACGCCCATCGGTAGCACCAGGTACTCGTACAATCCACTGGGCGCT
TGGAATGCAGTGTACTTGACA