Description :
From Genome Similarity Track
Location :
Scaffold_169:48894- 50062
Sequence
1168 bases(100 bases per row)
CGAACAACCTACTACGCGATGGATGCACGGACCAGCTCACAAGTCTACGGCACTGAAGGATACATCAAGGCGACACAGCCATGACATCGATGGCTCCATG
ATCTCCTTGTCGTTGTGTCTGTTGACAACCTACGAGATCAGCGACGTCGGTTACTGCATtGTTTAGACTCATCGACACGAGGGAATCGATGCTTCAAGTC
GCGAATATTTCAAGGTTCATAGGCATAGATGGTGTGCCAAGCCACTGTCAGCGCTCTGCTCGTGCCGATGCTTTCCTCATCGCTACAGAGGCAGAGACTA
GAGGAGGTCTCTAGACATGCAGCGCAAGGCGGGCAGTGAGTTGTGATTGAGATCGCTCAGATCAGAGAGATGGATCCCTTGGTCTTCATCCACCGCGAGT
ATTCACTTCTATATCTCATAAGCATCGCCCACTTACCGATTTTCCCCCCATATTAGAGGCGCGCTGCCAATGAGATGTGATCGCAAAAAGTTATCACAAT
AGAGGACTCGTCACAAAATCTAGTGACATGTTGTCACTAACGGGTCATTATTGGACTTTGGTGGTATGGACATGGCCCTCCCATGCACCTGCGCCGGGTT
CGATTCCCTCCACGTGAGCGATTTCCGGATCTATTGATGTTGAGAGGGTCGGTATTCTGTTTCAAGGGGTCCGGTTTGACATGGGCCTCCAACCAATCAT
AACACACTTCATTACCAATTCATTCAAAAACTCTTCAATGTAATATATTCAGTTAGAATGGTCGTCGCTGTCATTCATATCGAGCACGTCCATTGCTTCG
GACACCTCACCaCACGCGTAGTGCTGTATGACAGCgAGCTTAAAGTCGTACGTatactggatcctNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN