Description :
From Genome Similarity Track
Location :
scaffold_11:488899- 491796
Transcript NameFunction/comments
Plaha_PHALS_10739animal inward rectifier k channel (irk-c) family protein

Sequence
2897 bases(100 bases per row)
GTGCTTAATAGACGTAAAACGTACGATGCCTGCGTCCAAGAAACGAATACAGAACCGTGGCGCGCTCAATGTTGGGACTCAACAAGTGCCTGCGGTATTA
AAAGACTGGGTACATATTTGGCACGGGGTGAAAGTCAACAACGGGCCTGAGAATACGTCAATTTTTCACGCTGGCTCACGCATTGAGGAGATGCCATTTT
GGAAACAATTCATCCGCTTGCCTGCTAATTCACTCTTTCCACGAGTCCTTACAGCTTCGAATCCGAGAAAAACCTACAAGGATTTTCTATATGTTTTGTT
GAATATGCGATGGCCCATGCTGCTGACCGTATTGCTTGGAGTTTTTATGGTCAATATCTTCTTGTTTGCGGCCATCACGTGTTATATCTGTAATGAGCCA
AGTGAGTTCTTTGAGGCGTTTGACTTGAGCTATCAGACGTTTACCACGATTGGATTTGGGGTTGTTTATCCTACACACACATGTGGGAACGTCGCTATGT
CTGTAGAATCTTTTGCATCGATGATGATCGTATCCGCCGTTACTGGTCTCGTGTTTGCCAAGTTTGCAAGACCACAGGCCAAAGTGGCATTTAGCAAAGT
GTGCGTAGTACAACCGTATGGGAAGAAATACCTTGCACTGGTCGTGCGCGTGGCCaatgcaactcagtcgcgtGATGTGACACACGATGTAATCATGGAA
GCGGTGTTTAAAGTGAATTTGTTGCGAGTGGAACACAAGACAAAGCAGCTTCGAGCTCATGATGAGATCATTTCGGAAAAGCGACGACGTTCTCGTATTG
CTGCAAACTGCGATGTTTTGGATGACGAGGATGTTTTAGAGAATTCCTCGTGCTCTCAATCAAAAGTATTGACGTCGTACAACTTAAAATTGTTGCAGAA
CAATTTTGTGACATTTCGCATGGGCGTTGCAGTGGTGCACGTGATTGACGAGAACAGTCCGCTTTACGGAATGTCTCAAAACGACATTGCTTTATCGGAT
ATGCTGGTGGAGGTGGCGATGTCAGGTGTTGATTCGACTCTACAAGATACGGTCTCTGAGAGGTATATCTACACGGCTGCAAATGTGATGTGGGGATACC
GATTTGCTGAGTTGCTGGATTTTGATGAAAGTAATGCAGAAGTAGTCATGAACTTTGCCAAGCTTAGCACGGTAGAGACTGCCCCGATTAATGATGCCCA
ATATCTTAAGTCGAGTGTCGGTACCATGGATGACAGCAATACAGATGATGAGAGGACTAATTCGAGCACTTCTCTAGTAACACAGGATTTTAGCCAGCAC
GGACGTAATCAACTACTAGCTAATAACGAGAAGACTTCGATAACAAGCACAAATTCAGAGTCTTTTCAAGATCTGCTGTCACTATCAGACAATGCCCAGT
CGTCTGACCAGCAACGCTCTTATCTATCAAATTTTAAGAGAAAAAGTGGTCCAAGAAAATTTGGGATGGGACTCGAGCCGTTGTTTGAGCCACTTCTTCA
CCAATCTTTTGGAACGCAGCGACTAGCGAAAGCCCCAACTGGTGAAGTCCGAACTGCTCGAAAAGGCGGATTGCGGGTATGGAAGGCGCACGATCAGACA
GACGTGGAGGGAAGAAGTCAAAGGCATAGTGTGCTGCAGCCGCCAACGCATGCAAACCATGTTCTTCAACGTCGCAGTAGCTGTAAAGCTGCGCTGAACG
GTGTAGGTGACTTGACAGCGTTTGAAGGATTAGATGGCCACCGAGCTCAGCATGTACTTCAAAAAGAGATGGTGGGGTCGGCTCTAATCGATGGAGATAC
CAGTACAACCTCACAAGAAGATTCTCAGGATGTGCTTGAGGGTTTAAATGATATTGACACTCACGAAAATAAAAgcgaagatgacgaagaaaagAGTGAT
TCGGATAAAATGAGTCAGCGTTTGTTTCGCGCCCAGTCGTCAGCATCTGCTGTATCGATTGAAGTGGAGGACACGCCACGATTTTTACGTATCGTGCCCG
TCAACATTCCAAAATCTTTTAGCTTTTTACGTTTTTATCAAAGTGCCCTCCATGTGGGCTGGCCAAAAATTACCGTCGTGTTTGTGCTGTCATTTCTGGT
CCTCAATTTTACCTTTGGATTTCTGTATTGGTTAAACCTTGACCATATTTCTGTGAACGACGACATTGTGGTGTCTGACTATGAGCTGGCTTTTTATATG
AGCGTACACACACTTGCAACAATTGGGTATGGATCCATTGCACCAATGCGTGACGCCGTGTACATGAATGTAATCGTTTTTATCGAGTCAATGGTCGGCA
TTATTGCTGTGACGATTATCACGGGCATAGCATGGTCTAAATTCGCTCGACCACGAGCTCATATCCATTTCTCGTCCAAATTGATCATTTCTACCATTTA
TGGTCATCGATGCCTCGTATTTCGAGCGGCCAATACAAGGCACTCGGGCGAAGTACATGAAAACTTTTTTCGCATTGGCGTGATTCTTACAAATCGACGC
ACAGGTCTTCGACAAATGTACGACGTACCACTTGTGACTGCTGAGTGGCCATCCATCAAGTTACCGGCGACACTAATTCATGTGATTAATGAGAATTCAC
CATTTTACAAGTTTCACTCGCTAAATGATCTCTCACAATCGCGCGTCGCAGTCGTTGCTCTGTTGACGGGTTTGGATACAACCTTTTCAGAAAATGTCTA
TGCACGTAAAACGTATTTTTGGGATGATTTCGCCTACGACATGCGCTTTGCAGACTTTGCTATTGTCGAGCGTGATCGTGTGTTTGTAGACTATAAGCGC
TTCGACCGTCTAATTTCAGACGACCAAGACGAACACTTCGCGACCTCACCGGTACTTGGTAACGAGTCTCTTGTTGCTGATTTGGTCTGAGTCGTGT