Description :
From Genome Similarity Track
Location :
scaffold_231:48885- 49969
Transcript NameFunction/comments
g6033.t1 hypothetical protein PHYSODRAFT_262892

Sequence
1084 bases(100 bases per row)
TCATCGCCAAGCTCATGTTCCGTCGGGGTGTCGACCTCAAGCGTGTAGTGGTCATCCCCGACGAGGAAGACGCCATCATCAAGACGGTCAAGGAGCTGTC
GAAGTTCGTGGGTCCCAGTGGCTACGTGTTCACGACGGGAGGCATCGGCCCCACCCACGACGATATCACCTACGACAGCATCGTGAGGATACTCGGCTGA
AATATTTTAGAAGTTACTGAGCTAATGGATTTCTTGGTAAATGTTACCAGGCAAAAGCGTTCGATGTGGGCGTCGAGCTGCATGAACCGACGTTTGCTGC
ATTGAAGAAGTATGGCGAGGAGAAGTTCCCTGACATTCACTTTGACGACAGCGTCAAACGCATGGCTACTTTCCCAGTGGGTTGCAAGGTGCTACCGTCG
TCAGGTTGGACACCTATTGCCGTTATGAAGAACGTGTACATCCTGCCGGGAATCCCGTCCATGGTCAAGGACATGCTGACCTGCAACGAAGAACACTTCG
TCGGCGTGCCCATCCACCGCATCATTGTGCGTTAGGACTCCGACTGCTACTCTGTGGATTGTGGTTGTGTCTAACTTAGATTTATGACGCAGGTGAGCAC
GTTGGAATACGAAGGGACCATCGCAGCACCGCTCAAGAAGCTGCAAAAGGAGCATCCGAATGTCGCTCTAGGCAGCTACGTGAACCTGACAGAGGAAAAG
ACAGGAACGCGCGACACGAGCTTCAACACGCGATTGACAGCGGAGGGTCGTAACGCGGAGGAGGTCCAGCAGGTTGGAGACAAGTTGATCGAGCTATTCA
AGGGCAAAATCGCTGACTCCAGCACGCCAGGCGACAACCATACTACGTAGGTCAATCGCTACGTAACGGTAAGTGTGCCCTTGTATCCGGCGTGTTAGCA
ATAGACTGTTAGAGTTCGCAAGTGCTCCATAATACTAATATGGCAGAAACTGGTACGTTTTAACACCGTTTCTTTGTAAGACGGTCACATCAAAATATGT
TGACTTGCAAAAACTTAAATCCGGAAATGATGCGGTATGCCTCAAACTTGGTATACAGCAGTGCTACCACCTACAAAGTACCCC