Description :
From Genome Similarity Track
Location :
Scaffold_433:4888- 9187
Sequence
4299 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGT
TCCCAAGTTGTATCTTCATAGCCAGCCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCAAGTAC
CAACCGAGTGCTCGGTCAACTGTTGAACTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTTGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTCTAGGGGGCCCGCCGAGTGTTC
GTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCATGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAAAGTCGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCAAGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTACTGCTGTCCATTAGCCTGT
GGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCGTATTA
ATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATTTACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCTACGTCAGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAAT
CATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGATCAACATCTTCCGCAATGGGAAATGCCGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGT
TCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATTACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGG
CTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCATTTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTTGGTTCCAGCGCTTCAGTG
GCTAACGAATCCGCGACAGCGTTGTATTCTCGTACAACGTGAATCTATTTACCTTATTGAAGCTTGGCTGCGAGTTCCTTGTGAGTATTCAGCAGCGCTA
GCAAAGTTATCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGC
AGCCTTGACACCGTTTATCATACCTGTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAAGG
CTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCC
TGGCGTACAGCAACGCGGGGTCCATTCGAAAAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGA
TGCTTGACTGCAGTAGCTGCGCAAAGGCGGCATCCTTCTCCTTCACGCGCTGCGCCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCG
TCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAAC
AGCAGAAGTAACGCCGAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTT
CATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATG
TGAAACACTCGTCTTCAATTTTTTGAAAGAACGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCG
TAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAACCGAAAGCTCGGTGATGG
CCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAAT
GCTGATCCGACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGAC
CGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCT
CTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAATTCTCGGCGCTTGGCCCACGACTTGTTCTTCAGCTAAGCGCATCCTCTCCGAGTAT
TAAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTA
ACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCA
GAACCATAGGTAGTGCTCGAGATCTGTTAGCAGGTCGTCGACTAGCGGCATTGCATATTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATG
CAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGAGGCCCATAGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGC
GCAGCAGCTCGAACAGCTTGCCGAGAAATCGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGGGGCGTACCCCTGTTTGTCGATATCGCATACCGCTCC
GTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTC