Description :
From Genome Similarity Track
Location :
Scaffold_71:48876- 50006
Transcript NameFunction/comments
Phypl_g2379ATP-binding Cassette (ABC) Superfamily

Sequence
1130 bases(100 bases per row)
GGTGAGTGCTTCGGCTACTTGGGCATCAACGGTGCTGGCAAGACCACAAccatgaagatgatgacAGGCGATATTCTCCCGACCTCGGGCAGCGGCACGC
TTGGAGGCTTCGACATCCTGAGCGAGCAACTGGAAGTACGCCGCTTGATCGGCTACTGCCCGCAGTTCGACGCCCTCTTTGAGCTGATGTCTGTCCGAGA
GCACCTGGAGCTGTTTGCTCGTATTAAGGGCGTGGCGTGTGCAGACTTGAACAGCGTGGTGAAGACACTCATGCACCAAATGAACTTGGACGATTTCGAA
AACAAGTTAGCTGGCACGCTCAGTGGCGGTAACAAGCGTAAGCTCTCCGTTGCCATCGCCCTCATCGGATCGCCGCCCATTATTTTCTTGGACGAGCCCT
CGACCGGCATGGACCCGGTCTCGCGTCGCTTCATGTGGAATGTCATCGCTGCCATCTCCACGCAGCGTAAGGAATCAACAATCATCCTCACTACGCACAG
CATGGAGGAGTGTGAGGCACTCTGCACACGTGTTGGTATCATGGTGGGTGGCCGTCTCCGTTGCCTTGGTAGCGTGCAGTACCTGAAGCACCGCTTCGGC
GATGGCCTCATGCTCGAGCTCAAACTGATGGGCACACCCTCGCACGACATTGATGCTCGCGTGGCTTCCGTGTTTAGTGGCAGTGCttccacgacgacgt
tcTCTCGTGCAGAGCTGCGTGACAAATGTGAGGCGCTTGGCGATGCATCTTGGGCCGACAAGATTGTAATGAGTCATGCCACGGGATACGCCTTGGCAAC
GGCGCTCGAGCGTGATGGCACCATGCGACTAGGCATGCTCTGTGCATGGTGGGCTGCTGAGGAGCGATTCTTGGCGCTGGATGCGTTCCTCCGCGAGAGC
TTCGCCGTTGATGCCACCACTGGCGTGAAGCTTCTCGAACGGCAAAACGATCTCTGCCGCTACAAGCTCACGGGTCAGGCGCCGCGACTCGCAACCGTGT
TCAGACGCGTCGAGggcggcaagcagcagctagGAATCCGCGAGTACGCCGTCTCACAGACCACGCTTGAGCAAATCTTCAACAACTTTGCGGGTcagca
gagcgaggagaaAGGTGTGGCGCGCGGTAT