Description :
From Genome Similarity Track
Location :
Scaffold_1:488724- 494469
Sequence
5745 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCGGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCGAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCACTTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACATGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGAGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCCACCCGCCAGGGTAAGAAGGATTTATTTGACTACGTCCAAGAGTTGAGAACTCTTATCGCTGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCATGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGGGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGAGC
CTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTTTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTGCCCGTTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGTGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCT
GGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCATCCTAGAAGGG
AGTCAGCTGTATGCTGAAGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCG
ACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGA
ACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGT
AAGCAGAAGCGCTTCTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGCTAGCAACGAGGTTGCTGTTTGCCTTG
AGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGTTCCTGGTGAGGACGAGCGCGGAGTGGCGCGCAA
TCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACTCGAGGGTCGCGGTCGACTACGAGTCGAGGCATCATGGGCGTGGCCCAGGTGAT
GCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACAGTGTATCCTCTTCGAGGAGTGATG
GTGCTGCTGCAACCGGTGGTGGTGACGAAGATGTCGCCACACCGCTCTCTTCCGGCCGGGCTCGGTCGCGGAGGGAGGGGAGAAGAAGACGCAGGGCGTC
TGTGACGTGTTCGACGTCGGACGATGTGTCCAACGTGACGAGTGGTGATGCTCCACGTGATTGCTGCGAACAGCTGTATACACTCGTGAACGGAGTGACG
GGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGATGCTCTGCTAGCGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAA
AGGCAGGCGAGCTAGCCGATATGGTCTTGCTGGGACCTGAGGAGGAGTTGAATTCCTCATCCGTCGTGAACGACGCGGTCCTAGAGGACACCAAGAAGGC
GCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCG
ACGAGTCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGT
GTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGCTCTGTGTCAGAAAGCC
GAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAAC
ATGGTAGGCTGTACGTTGTACAGTGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGATTCCTC
CGAGCGGGTGGCTCTGGGAGTGGCTGGTCATGCCCCCGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCG
GGCGTACGCTCAGACGTACTTTGACTATATATTCGTCCAAAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTG
CTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTG
GCTTACGGGCAGATCCTGCCAAAGTCAATGCCATCGTGGACTGGCCGGTTCCAAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTT
GCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAAAACTTCTTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGC
CTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCA
ATCGGTTGTGCTTTACTGCAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGCTC
ATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTT
ACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGG
CTTAATATAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGT
ATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGTGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTAAGCGCTTACGCGCGAGGCT
GCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGCTCCTCATGATGAGGATCTAAAGTATCGA
ATCCTCTACGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCTAAGATGTATA
AGTGGGTCGGCACCTATGTACGCATGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGG
ATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGGAGACCGATTGAGCAAGATG
GCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGATACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTG
TCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGAC
CGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTT
GAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCTTTGATGTGAACGGCTTGGTTAGCCCTCGCGTCCCACTGACGCCGCCACGCAG
TGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTG
AGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGG
TCGGAGACCAAGTTTTATTAAACGCTAAAAACCTGCCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAA
GGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCAAAGAAGATACGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCAAGAC
CCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGACCACGGACAGCTGCAAGGCAGCAAGTGGTAGGGCCACGGGAGGCTGAACGACAGC
AAGTGGTGGATCCACAGATGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCAAGCCAAGCTGAACGCTC
AGCCGAGCGACTGGACGCTCAAGGTCCGAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAACTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGA
TGGACGGTGAACGGGAACGCTCGCGTCGTGGACGCCGGCGTCGTATGGACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCTGA
GGCAAGGCCTCCTCCAGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAACGCCTTGTGGCGTGGCGTAGACGCCAGGGTCGTACCCAGTAC
TTGGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAG