Description :
From Genome Similarity Track
Location :
Scaffold_1546:4886- 7286
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1546-fgenesh-gene-0.3Pantothenate kinase
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1546-abinit-gene-0.15Gene of unknown function

Sequence
2400 bases(100 bases per row)
CTTGGAGTGCACGCGCAGACGGACGTCTTGGACGCCCGTGTCGCCAAAGCACTCGTTCTCCATGAGGAACTTGGTCATCTCCCCCGCAGCGATCTCGTGC
GACGACGACCGCTGCCGCTTGCGGTTGTCCAGCGATGGTGAGGACGAGGATGACGACTCGCGCTTCTCGAAGTACACGATCTTTGCCAGCGTACCGCCTG
GTAATCGCCATAACACATAGAAAAGAAGGCAAACACACACGTACGTCAGCAACAACAGATCGCTAGCCACACACAAGAAAGAAAGCCTGCGGGCGTACCG
ATATCCAGCCCAAAGCAGTGCCCCAGGTCCGAGCTGCACCCTCACAAGCACATCGCAGCATACACCGTGTTAGTAACGTCCGCACACGAGCTCACCCACT
CGCATACGCATACACAGAGAGCGACAAAGAGAGAGAAAACCAAAATGAAGTGGGGGGCGTACTTTTTCGAGATCTTCTTAAAGGTCACGCGCTGGCGCCA
GAGGCGGTGGCGGTCGCGCTTGCGACGCACGCAGAGCAGCAGCACGGAGCCGGAGAAGAGGAAGAAGCCGCTGGTGATCAGCGCGCGCTCCCCCATCGTG
CGCGCGCAGCAGTTCGCTCTCTCGCCTGTACTGAGGAGCTCTTCGTCGCTTGTGCGTGATTGAACTTCTGGAGTGAGCAGAAAATATTAAATGGAGGCCT
TTCATTGGTTGAAAATATGTTTTGCTGCTGAATTATAGCAAATGAGATGTTTTTTTCTTCTTGTGTATGGTTTGACTGACGTCGACCGGCCAAGCGATGA
CGTCGATCGGGATTCTAAGGAGCTCTTCCTTCAGTGCTCGCCATGTGCTCGCTTTCCTCTCTCTCCCGATACATGAGGCAGTGGCTCAATCAGAGGAGTA
CTTCCAGGCATATGTTCAAACATTGCTGTACATGTACACTGTATCGGATGTGTCATGTTGGGAATTATCACCTGAGATGTCTCTCAATGCGAGATGTGAG
ATCATAGATTCACTCATTCGTTCGCAGGTCCACTTCAAAGTCCTAAAGGATATCAGAATATTGAGATAACGGATGTATCGTGCAATGTTGCTGAGTTCGC
TGAAATCAGCACTTCACTATGCTGAATAAATCCAATTCGACTCACATCAGGCGCCACCAAAATGTGTCGTCTTCGTCGGAATGAACTGATTGCTTTGCAC
CATGCCCACCAGAGCGAGGCTGATTTTGCTACCTCGACGGCATGATTTCGCCTGCCTGAGTTTAAATTGAGCTGAGCTTTCCAGTTGCGCCTGACTGACC
TTAAACCAGCGGATGGATGCACTGGGTACAGTACACGTCCTAGCCTTTCAAAGACTGGAGCTGGGATAACATTGTGGGTCTTTGATGAACCGGTTTTGTC
TGCTGCACCCAGGCACATGAGCCAAAGAGCCGAGGGCTCACTGTGCTTTGGATTTTCCTGGGATCGCCCGCGTGTGAGTCTTGAAGCGACTGCCACGTGG
AAATCCACATCGAGTGCGCATTTTACCCATCGCATTGTGGTGGTGGCCACTTTGCAGAAAATTCACCAGTAGCCTTGGCAACAGCGTGTCCCTTCGCGTG
GAAAAGAGAGCGATGGTCAGTTGTATACGACCAGCACTCTGCTTTTTCTGGCATGTCCAAAAATCCGAACAGCTCTTTTCATGTTGATTTTGTGTGTGAC
AACAACCTGTATAAACCAATATTCAAGCATACTTTGTAAATCAATACCCTCTTAACTTCCAATTCTGTTAAACACTACATCAAACTAGTTTTATAGGTAC
ATATACCCTCTGAAAACCTATATATTGACATTATGTGCACCACACGAGAAATGTTAGATCGCTGGGTGGGACACTTGAATGCACCTGGATTGAGGTGGAC
TGTTGGTAATAATCCGGAGCGAGCAGCCAAGGCGTGGATGATGGCTCCACGCGGCCAGCCATCCTGCGCATCGCCCCCGTGAGCGCATTACCGAACTCGC
CTCCACACTAACAGGATATGCCGCTCTCGTCGTCGCCCCCGCAGTCCGTGCGCCCGCGCCGCCTCACGTTCACGACCGACTCGGCGCAGCAGCAGTACCA
GACCGCCATGAAGGGCGTGCAACACTATCTAAGCACACACATGCCCGCTGACCAGCTCGAGCTCCTCGGCGTCAACGACTTCCGCGCGCGCTACTACTAC
GACGAGATCCAGCAGTACTTGGCGCAGCGCGTGCGCCACGACAAGCAGTCCGTCAAGCCACAGCAGGCGTCTCACACGCAACGACACTTGCAGCGGAGAG
ACAGCGACCGCTTGCTGCTGCAGAACCTTGATGAGTTCCTTGACGAGCTGGACCCCGCGCTCTTCGAGCAGTGCTTGAAGAGCGAGCGTAAACAACAGCC