Description :
From Genome Similarity Track
Location :
Scaffold_41:488581- 489678
Sequence
1097 bases(100 bases per row)
TTATCAAAACCTAAACGATGTTACGGTGAAGGACAGTGACCCTATGCCTTGCTCGACGGCATCCCGGCCGTTCTGTGGAACGCCAAGTATTTCGCCACAA
TGAAAATTGCCTCAGGGAGTTGAAAAGCTCCCTAAAAGCTGCAATGGATTGCGACAGTGTGGAGAAGACGGCTTTTACGAACAAATTTGACCTCTATGAG
TGCTAGGCCGTACCGTTTGGATTGTGTAACGCCGTTCCTGCATTTGAATGTCTAATGGATAGCGTTCTTGCCGACCATAAGTGGAGGACGTTTTTTGTCT
GCTTAGACGACCGTGTTATCGTCGGTAACGGCTTCCGGACGCATTCGATCCGGGTACGTCAGGGTTTGGAACGTCTTCGAGCCGCGGGGTGCAAGTTAGA
GATGAAGAAGTGCCATTGAAGAGTGGCGTTCCTCGGTCAAAGCGTGACTCCAACTCGGATATTGCCGAATCCTGAGGGGGCGGCGGCGGTGGTGAATATC
GAGAGGCCGCATGACTTGCACACGGTTGGAGCATTCTTGGGAGAAATAAACTAATTTTGACGCTACATACCGGGGTTTCGCCGCGATTGCTGCGCCGTTG
AAACGTTTGAAGCAGAAGGGTGTTGAGTTCAAGTGGAGCGAAGACTGCGAAGGCGCGTTCAGTCAACTACAACGAGCACTGGTGAAGCCTCCGATACTGG
TGTATCGGACTTAAAAAGAGATCTAAACGCTACGTAGATTCGTCAAACTTAGCGGTGGGAGCATGTCTAATGCAAGAATTCGATACATGAGACTGGGATA
TCGCGTATGCTAGCAAGGTGTTGGTTGGATCGCAGCGGAACTGGGTAAACAAGACAAGTGGAACGACTGAGATCGAGTGCTGGGGAATGGTGTGGTCTAC
ACACCCGTTCCGGTGTTATCTGGGCCATGCGGAGTTTGACCTGTATAGGGCCCATCAGGCACTCACATGAATCTTCGGCGAGACCACAAGGACGTCGAGC
GCCAAGTTCGCACAGTGGGTTATGGAGTTGTCGCTGCTATGGTTCAAGATAAATCACAAACCTGGGATGCCGATGGGTCACACAAATGGTTTGCCAA