Description :
From Genome Similarity Track
Location :
Scaffold_52:48851- 50707
Transcript NameFunction/comments
Phyag_g1256hypothetical protein PHYSODRAFT_293654

Sequence
1856 bases(100 bases per row)
GCTACGGGGTTTGTGGTGGACGCCGAGAAGGGCATTATTCTGACGAATCGCCACGTTGTGGGGCCAGGGCCCATTGATGCGGAGGCGGTGTTCCAGAATA
ACGAGGAAGTGCGAGTGATCCCCATTTACCGCGATCCGGTGCATGACTTTGGCTTCTTCCAGTTCAATCCTGCCGTAAGGACTTGTGTTGCTATTTTCCT
GCATTGTTGGGGAGTAGGTTGTTTAATTATTGTTATTATtatctgttgttgttgatgatgttgatgctGAACAGGATGTCAAGCACATGACTGTGCCGTC
GCTGCATCTGGAACCCGAGAAGGCTACGGTTGGGACGGATATCCGCGTGGTGGGCAATGACGCGGCTGAGAAGCTGGCTATTGCTAGTGGCACGTTGGCG
CGTCTCGATCGTGATGCTCCGAACTACGGATACAACAGCTACAACGACTTCAACACGTTTTACTACCAGGCTTCGTCGGGTACGATGTCACTGAGAGACA
TGTAGCGTCATGTTCTGTCCTAAcagttgctgttgtggcCGATGTTTGCAATCGCAGGAACCACGGGAGGATCTTCCGGGTCCCCTGTGCTCAATCATGA
TGGCGATGCTATTGCCCTCAATGCTGGTGGAAAGATTGGCACGTCAGCATCGTTTTACCTGCCTTTAGACCGAGTTAAACGAGCGTTCGATTTAATCCGA
GAAGATAAGGACGTGCCTCGTGGCACCATCCAAACGATCTTCAACTACAAGCCCTTCGACGAGGTGCGTCGACTTGGCGTGGACCCCGCCACGGAGAGAC
TTGTTCGCTCCTCCTTTCCATTGGAGACAGGTATGCTGACAGTGGCTGAAACGATCCCGAGTGGCCCATCGAGCAGCAAGCTTCAGCCAGGTGACGTTCT
GGTGCGAGTTAATGGCGAACTGATCACGCGGTTTGTGCCATTGGAGGCCATTTTCGACGACAACGTGGGCAAAGAGGTACGATTTTTTTCCAATTGTTTT
TTCCATTCACGGATGAGTTCGTATAACTGATTGGTTGACGTTAAATATCCCCATAGATTGAGCTGCAAGTTGAACGATCTGGTGAACTGATGGCATACAA
GGTGCAGGTGGATGACCTGCACGCAGTCACTCCGTCACGTTTTATTGaaattggtggagctgtGATTAATCCGCTATCGTATCAACAAGCACGGAATCAT
GCCATGAGCCCTGGAGCTCCGTACGTTGCTGACCCAGGCTATTTCCTCCAACGTTCGCGTATTGGCCGAGGTGCGATCATTCACTCGGTGAATGGAATCA
AGACGCCCGATCTTGAGACACTCAAAAACTACCTGAAGCAGTGCAAGGATCGCGATCGCATCGTGGTTAAATTCTCGAAGTTGACGGATAAGTCGGAGAA
GGTCGAGGTTGTGCATGTGGATCGCAGGTGGTTTCCGTTTTGTGAGTATGTGCGCGATGATAAGCTTGGCACGTGGCATTGCGAACATTTTGTTCCTCCC
GTCGAAACTATGAACGCAGGTGGTGCTGACAATGACAAGGAGTCAACCGAAGACGAGCCGATtggttcgacgacgacactgCCCGGCAAAAACCCGGTGG
AGAATAAGCTTGCGCGGTCATTAGTAACTGTCGATTTTGACAGACCTTTCAGTGTGAACAGTTTGTCGACGTCGAATTACCGGGGTACAGGACTTGTGAT
CGATGCGACGAAGGGACTTGTGGTAGTTGATCGCAACACCGTGACGGACTCAATGGGCGATGCTATGGTAACGTTTGCCAGTACCATCATGGTTCCTGCT
CACGTCGTATTCGTTCACCCCGTGCACAACTTCGCCATCGTACAGTACGACCCGAA