Description :
From Genome Similarity Track
Location :
Scaffold_82:488433- 491098
Transcript NameFunction/comments
Phyin_T30-4PITG_18845Putative uncharacterized protein

Sequence
2665 bases(100 bases per row)
GTTATTGTGACCGACTGAAAGGTACGAAGACGAGCCATTCGTGACCGACTGACCACCGACGTGACCGATTGTGCCCGACAAAGAAATTCACCCTTCTTGT
ATATGCTGTATAATCCGGATACGAGCACTTAGTGTTTTTAGAGCAAAGTCATCCTCAAGGCCGATGTTAACCTCAAGGACGAATCCAACCTTTCTGTGAT
GTTTCCGACACAATGTGTTTTAACAGCAACTAAATAATTCAAGTTAAACAAAGTGTATTGCTTCACATGCACATCTGCAAGTAGCGATAACGCTGGTACT
GCAGTGCCTTCTTACTCAATTCACCTGTGCTTTCTCCGCTACAGAACGTTTCGAATGCAAGCAGAACGTACACCCCACAGTTGTAGCTGTCTAGTTGGAC
TTCAGCATCCGCAACATAGGGAACCACTCTGTAACGTCCTGGTGTAGCCGACATGTGTTGCACAAGTTTGTGCGCTAGTACTCTAAGGGTACCAGTGTAG
CTGCTGCTCATGGAATCATAGTACTTGATAGTTGTCTCAGCTGTGTTGATCATGATACCGCACCAGTGCGTGCCGTTACAGCTCACTGGAAGCAGTATAA
TTGGCCCAGTAATACAACTGAACAAGTGCTTTAACTCTTCGTCTGGAATGCTCACATTTCCTCTCTCCACGATACCCCCATATAGCTGGGTCAACAGTCA
TGACTTCCTCTTGCTGCCCAAATAGCTTTGCTATTGCCTCTGCCAACGCAGTGTCACTAAGTAGTGATCTGCATGCAAAGTCAACGATCCGAATCTACAA
AATACGTATACAAAGTGTCAGTTGCTGCTACCCTTAAAATATGCAAAGTGCTTACCCTTTCAGAGAAAATCGGAATTGCTTCTAGTTTTGACGCCAATTC
TGCATCTGGTTCGGCCCGAAATACAGGCGAAATATCCAGCGAGAAATCAATTTCTGATATCCATTTTACGGCTCTCTCGATATTGTTTAGCTCTTTGACT
GCTTGGTGCCATAGCTTCATGGTTCTCAGTGTCTGCATCCCGATTACAAATAGACCAGGAAAATCAACTGCAAAGTCTAGCTCTGGCAATTCCTTGTGCT
TCTTTTGTAGGGTAACTACCTTTTTGCTCGCTCGCTGGAGTATCTCTTTGGCCAAAATACGAGAAATGTCGATTGGATCCATGATAACTTTGTTAGCCGG
CATCTTCGAAATAAGGTAGGGCATTGGGGGCTTCATCTTCTTATCAAAAACAAATAGCTGGAATCGGCGTAGCGGCTCAGCACATGATGCGTAGGTAGGT
TCATTTGAAAGGAGAACCTTGACTGTTTTGAGGCTCATACCTTGGTCGTGAAGTATCGAATCATCTTGTGCCATTAGGATAGATACATTCCTCTTCGCTT
TCTTAGTCTTTGCCTTCTGCTTCGGGCGGCCTCGCGGGCGTAAGGGACTTGCTATCTCGAATCCAGGTGATTCCGCATTAATTGGTTCGGATTCAAGAAC
TTGAGTCAATTGCATCACCGAATGATCCACCAAGTGATCCACCGATTGAGGCACCGACTCCACCGACTGCGGCACCGACTCCACCGCCTCTACCGCGTGA
TCAACCGCCTCCACCGACTGGAACACCGCCTCCAACATCGGGGACACCGCCTCCACCGAGTGGTCAACCGCCTCCACCGAGTGGTCAACCGCCTCCACCG
ACTGGAACACCGCCTCCAACATCGGGGACACCGCCTCCACCGAGTGGTCAACCGCCTCCACCGAGTGCCTCCGCCGACTGATCAGCCAAGCCACCGACTC
TACAGACTCCACCGACCGAGACACCGACTCCACCGACGCTACCGACTGAATCACTGACTGAGGAACTGGACCCATAGACGACAGCTCCTTGATCAGCTCA
AACTTTTTTTCAGTAAACATCATTGATACTTGCGCTAACGCCTGAATTGCCACCCGATATTCCGCCATTCCCAGCGTGCTTACAGCTTCCGTTATGGCGG
TAGCAAAGCTATTAGCTTGGCGAAATTTGCGGTTAGAGTCCCACGGAAGCTTTGGAAGCGATGCAATCCGAGTCACAGAACAGCCGTTCCTTTCGGTCTC
CAACGGAGGACGCGTGTCATTCATCGAAGACAACAACCAACGAGGATGGAAACACTGAGTCGGAATAATTGTCTCCAATTTCAGTTGCTGACGCACGTAG
AAAACATGCCTGCATGGCAATAGCCGCGTACTTGCAAATATACACGAACACTCCCAGGTTGACTTAGTAATTGTGTACTCTGCTCGTGGCCCGTCCAGAC
TTCCTTCTGCATCTTTCTCATTCTTGATAAAGATCATTCCAGGCATTGCCTCGTAAAAGGAATAGGAATCCGGACCAGTTGCGTACACGTACTGCTCATG
AATTAATTCGCATACATGCTTGCTAACCAAGTTAGCCACGACATTCATCTCATTATCGTATTCTTCGTGATGGACGTGATAAATCTTGGTTGCACGGTTG
TACAGAAGCTGTTCATATCGAGTCTGATAGAAAATAATTGAAGCCAAACACTCATCTAAGACCATTGAAGAATTTACAATCTCCTTCATGTGCTTCCAGG
ACGCCTCAAGTCTGTTATTGGTGTTGTTGCCCAACGTCACCGCACTTTGTCTCGTGAATGAACAC