Description :
From Genome Similarity Track
Location :
Scaffold_439:4883- 6201
Sequence
1318 bases(100 bases per row)
TGCACCAACGCAAAGCCGATTGCAAAGTCACTGGCGTCACAGACTATGTGGACTGGCCTGTCTTGGTCTGCAATCGCTGTAACTGGCGATTGTATTAAGC
TTTGCTCGATACCTTCGAAAGAGCGCTGACAATCGGCACTTAATATCCACTTCTCGTTCTTTTTACTAAACGAGAGAGATGGACAGTCATCTCGGCGTAA
TTGCGTGAATATTTGTGCAAACACGACGCTAGACCAAGGAACTTCCGAAGCCTCATGACATCTGTAATCACCGGCCAGTTTGTGATTGCCTTGATCTTTT
TCGGATCGGGCCGGACGCCATGCTTACCCACGATGCAACCAAGAAGTGGTGTTTTGTTAGCATCAAATATACACTTCTTGAGGTTGGCATAAATTATGCA
CGCGCATAATTGTAAGAATCTTCCGAACGAGGAGTCGGTGCACTTCCACATCCGTCTATTCCTTTATAGCCCGGCTATGGACAAACACTTCACGAAATAG
ATGGGCACAAACTACCTTATGGATCTTAACAGATTCTTCACACATCTTTAAATGTGATAAAGCATTACTTAGCCCTTAAGGCATGACTGACCACTCCCAA
AGTATACCGCTTGGGGTGCTCACTTCAGTATAGGGAATGCCCCTCTTGCGCATAAGGGTTTAATAGAACCCATCCATCAGATCCATGGATGAAAATATGG
TACTTTTGCCATACCATCTATGATGACATCTTTCCTAGGTATTGGTGTTTGAGCCGGTACAGTAGCAGCATTCAACTTGTTAAAGGCATTTACTATCTGC
CACCCTCATGTGGCTTTTCGCAAACAGAAGGTCGGAGAGATATGTGTCGATGTTGACTCCCTCACATTGCCGGCTGCTAAGCGATCTGCAAAGAATTTGT
CGATCGCTAGTACTTGTTCACGAGGCAGCGGCTATTGCTTCATGACACAGTACTTCGAACCCGGTTTCAGGTCGATTTCGTGACGAGTACCTTTGTCCTT
AGTTAATTCGCATGGGATTGCTTCTGGGAATACATTCCTGAATTTCATCAAATCATCGAAGAGAAGATTTGCTTTGAACGATTCCAACGATTGACTTATC
CCATGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTACAGAGAACCCTTTCACCCTCGGTAAAGACCATTGCCGATCGGATATCACCTAAAAGT
ACTCATCTTCCGCGACGAGTACGCAGATGTGCTTGACTTTGCCACTACGCATATCACGCAAGATTCTCTTTTGGTTCACCAGAGGGAACTGATTGATCTC
CAAAGTTAACTTCAGAGG