Description :
From Genome Similarity Track
Location :
Scaffold_77:48828- 50819
Transcript NameFunction/comments
Phyke_g3251hypothetical protein
Phyke_g3252conserved hypothetical protein

Sequence
1991 bases(100 bases per row)
ATCAGCTGTCCTTACAAAGTTCGGGAGGAAGTGCACGTGACCTATAACATGGAATTTGCACGCTATGAGGGATTGCCCGATGCGTGGAGAGAACTAAACC
ATCAATTCGGCCTGCCACTCGAGGCAGTTCCCAAGCGAGAGGTACGAGGATACAAAACCAAACTTCCTGCTATACTGGAAATGATGAAGATCCGGTTTCT
AGCTCACAACGGTGCCCACACTGAAGGTGTGTTCCGCCTGGCACCGGACAAACACATATGCGCCGCGGTCAAGCAAGCGATTAATGATGGCTCTTTTGAT
GACTGCTCCGACGTGCACATTTTGGCCTCACTCATCAAGGTGAGGAATTGAAACGGGGTCTACCGTTGATTTCAAATctcatgctgctgcgttgtTGTGT
ACAGGCTTGGTTCCGTGAGCTGCCAACGAGCCTGTTCGATATTCTCCCAACCATTGAGCTGGAGGTAACATTACCCTGCTTTTTACTTCATGTTGTGCGT
GTAGCTTCAATGGAACTGACCAACATCTTGCAGGGGCCGAATCCGGAGACTGCACTCCAAGTTCTGGAGAATTTGCCTGCCCTGCAGCGAAGTGTTACAT
TTTGGCTCTTGGATCTGCTTAATGAAGTCGTAAAATATGAGCATGAAAACAAGATGACGGCTAAAAGCATGGGTAAGCTTCCCGCTATCCATTGCTCAGG
AACATAGTAATACTAACATATATGTATATCCTGTCCTGTAGCAATCGTGATAGCTCCAAACCTGCTACAGGTAACGAATACTGATGCTGCGGTCGTGCTT
GCAACGTATCAACAAGTAGCCGACTTTGTGGTGGCACTATTGCAGGCACGATTGCTTCAACGGACAGCAAGCTGATGATGGAGTAGACCACTATGTGCGG
CAAAAACAGACGTCAGGACACTAGTGTTGATGTCGAAGATGTTTTTATTGATATTCGTTCAATAACTTAAAAGCTCGTACATAGCGGCAAAATGCAAAAA
GGAGATGGAAGCAGATGACCACGAGGGAGGACGACACGATATGTCGACACAACTAGCAAACCTGGTGCTTCATGTTACACAAGACAGCCGTACTCGGGGG
AAATGTGGCGAAAAATGTCGTCTTCGAGGCCCTCCAGTCCGTTTAGGGCGGTGGTAGTTGAGGATCTCTCGGGATTCGACGCAATGGGGGCTACAGTCTG
AGCTACTGAAGCTGCTTTTCGCATAGCCATGGTTGGCGACGGCTGCAGCGGGAAGAAATCGTATGAAACGGCGTCCAGCGAGTATCCGCAGGATGGGTGG
TCATTTTCTCCATAGGGGTCCATGGTAGAGGTGCTGAGCTCACCGAAAGGGTCGTACAAGGTGTCGAAGACATGGGTGGGGATCATCCCACACGTTTGGT
TGTATTGGCTGTACTGCGCACGGCTCGAAGGTACAAAGTCTGTTGCCGGGTTCAAGGGCATGGAGGCGCCAAAGAACATGGCGTCACGATTGGGTGACGA
CGCGGAGGCTGAGGACGGCGAGTCTGTGAAGAGATGTTTGCGTGCCTTATTCCTGTGTGCGAAACGTTCGGCAATGCTGACTCTTGGGCTCTGTGACCCA
CACGagtcctcgtccgagtcgtGATCATCTGGAGTGTTGCTGCCGTCTTCATTGAAGAAATGTGCAGGTAGCGCTTGTCCGTAAGGGTCGATGCCGTAGG
TCTCAGGGGACAATAGACGTGTGAGTTGGCTCTGGTATCCGGCATGTTGCCGGAGCTGCTTGTCAGAGAGTGGGGGGCCTGATCCGTCttgtgcttgctg
ctgacactgctccagctcctgcagcgaACGCTTGAGACTGCGCACTTTACGGTAAGGCCAGTGGCGGATGCCAATTGCTCGGCATCTTTTCTTGAAGGCT
GTGGCTCGTACGCCAAACTTCTCAGCCGCAACTTTCAGTGGTAAGTGGAAGTGGCGACTTAGCGCCGTGAAGTTGCAGGTGGCAACTGGCA