Description :
From Genome Similarity Track
Location :
Scaffold_253:48817- 51113
Transcript NameFunction/comments
Hyaar_Emoy2813213AlNc14C90G5653

Sequence
2296 bases(100 bases per row)
ATTACAGTGTTGCACGACGAATGCCACTTCGATTGCTCCGGTGCAGAAGTCTCAGATGTTGTCAACCTTCTCTCGTGCTTATCTGAATTAGGGTCGTCCG
CAGCTGGCTCGTCGCTTGCACCAATCTTAGCGACTGCAGCTTTATATGGCGAGCTGTGTGCCTCCGACACTACCTTAATCGTGCGCTCTGGGGACATGTG
CATCGTAGCCGAAGCATTCATCGACGCAGCAGCGTTTGCTTTTATGATATGCGTCTTCGACGTCTTTGCTTTTGCCTGCATACTTACGTCCATCCATGCC
GCATGATCATTTGACGAGTCAGCTCCTGCTTCTGAGGGTGCTAAGGAAATCTTCAGTATAGCTTCAGCCGGCACAAATTCTTTCGGTTGTACTGGCATCG
CAGCATCTGAGTCAGACAGAGCCCTCCTAGCATTCTTTGCAGCTCGTTCACTCGCACTCTCAGCTGACCGCGCCTTCACTGACGAAGCATTAGCCACGTC
TGTCAACTTTCGCTTCTTTTTCGTCGGTCCCTTCATAGCCCGGCCCGTTTCTGCTCTTTTCTCACTCTGACCCCCCGTCTTCTTCTCTCCTGCGCCTTCT
TCACCATCGGCCAAGACGCCGCTACTCGCTTTCCCTAGCTTCACCGTCTTCGCACCACCTGCTTCACCCTCTTTCGGCGTTGTCACTTTCTTCAGCGCTT
TCGCAACCGCATTGCTCGTGACACAAGTTGGGTTCGCGGCTTTCGCCTTGAGCGCTGCTCGACTGTCATTATGGAACTCCCGTGCATCATCGATACATCG
TGGACAGACATACGTCGAGTCTTTCCACCTGCCCGAGCTCTTAATAGGCGGCAAGCAGCCAATGTGGAACCAACTGTTGCAGCAGTCGCACGCCAGACTC
TCGTTAATGTGCTCGTCCTCCATCGCGTACCAATCGTCAAACGACTTGCTCCATCGCGTAAAGTGGATTTTAATGCGCTCGCTCGGCGCGTCCACTTCCG
TGATCACGGCATTGTACAGCACCTCGTCATTGTCTACGAGTACGGCTTGGTTCACTTTAAACCCCGTCCCAGCCGCCGTCTTCCCGTCCTCGCCCTCTCT
CCCCGTCATGGCGAACGGCAGTCGACAGCTGCCACATCGTGACCCCACGTCGTCGTCATCGGCTGTACCCATTATCTGGTCCTTGAGGTCTGTACCCATC
GCCTGGTCCTTGTCCTTGTCGTGTGTACCCATTGCGTGGCCGTCTACGCTCTGCTCGGCTTCGCACTTGTGGCAGCAGAAACCGTTCGGATTGCCCACGT
CTTCATCCCGCAGCCGCGCGCACTTGAGGTGGAAGCCCTTGCCGCACCACTCGCAAAAGTGGTCGCAACTCGTGCGCGCGCACTGGACACAGGGCCGTTG
CGAGCGGCGGTAGGCGACAAAGTCGCAGATCTGGCAGCCCGTGGACGCCTCGGCGCTCTTGCTCTTAATCGACGCGCCACGAGCGACGCCCTCGAGCAGC
GCGTTGTTGCCGCACTGCTCACACTCGCGGTGGTGACCGGACGCTGTTAAGGAGCTGCCCGAGGACGACGTGGCCGAGAGCGCGGGGCTGCTGCTGCCCG
TGCCGAGTGCGCTGGCCTTTTTGCGGCGTTTTGGCTGCGTCGTGCTGCCGCCTTTGGTTTTGGGGTGCCGCGCCATGCAGAGTGATGGTCGTCTTGTTCT
CGCTCGTTTGCTCGCTCTCTGCACGACGGGAGCGGTTTTAAAAGTGTTCGAGATCCTCCCCCGAACCCGCGCCGACGCAGCAGGCCAGGGTTTGAAAAGC
CTCGTCTTTGTGCTTACACGACCTTCGCGCGACTTTTAAGGGCAAGTCGTGACAAAAGCGGGTCTGGCGAGAGGACGATCGCGTGGGAGGAGGCGAGAAA
GCGAAACCGTCTGTTTTGCGCGCAACAACTGTGGATATAAATAGCAATGAGCCAGAGACGCAGCACGCTCGACGCGTGCGATTGAATGTGTCGGCCAACA
AGGATGGCATCACTGTGTGTGAGCGTGCTTTTTTCAGAAAAGCAATTCTTTCTTGTTAGAGTCAATGTCGTCAGAGGAAATAAAATGGTACAATCATTCA
ATTATAGACTGAGCGCAAAATCTAGGACTACCAGATGGTGCAGCCGCCTGGCTCTGTGCATGTTGTAGATGGGGCACGCACACTTATCCAATAATGGCTT
AGGCGAAGGTGACCGACCACGTCGCCAGAAGCTCCTGGTGGCGCGTCACGTAGTGTCCCATCCAATCAGCGAGTGCTACATTCACAGCACCGACAA