Description :
From Genome Similarity Track
Location :
contig_18:488144- 497701
Transcript NameFunction/comments
g4663.t1XP_009529812.1 hypothetical protein PHYSODRAFT_510095 [Phytophthora sojae

Sequence
9557 bases(100 bases per row)
CTACGTGTCGAGTTGAGTGAGCAGTGCGACGCCACGCCTAATCCAATGTTTCTGTCGGTGCTGTTCACTCATCGGCAGTCGGACGGACATGACGAAGTTC
GTGGAGTGGCCTGTGGTAGACAGCGTTCCCTGGCGCTTGGAAGTCTTGTACACCGGGCAGAGATACACATGTGCTGTCCCCTTGGGGTCCGTGTCTTCAA
TAGGCTCGATCTGGTCCCGAGCCTTGGGTAGTAGATGTAGAACCGGCAACGGCACGTACAGCTCGCGCGGCTTGGATTCAGCAAGTGAGTGCGAGTTGGC
GTCCCAGCATGCGCCTTCGAGGAAGAGTCCGTCGACGTAGGCTCCGTCCTCGGCTGGTATTGTGAGCTCTGATGCAGGTTGCGCCAGCACCACCATGTCG
TAGCCGACCTGGTCGATAGGGAGCTTGTGTTTTCGTGCGTAGTTCTGCTGGGTTCCGGTAATGAAAGCTTGTGTGAAGAAGAAGCCCGAGATCCAGTACA
CGGGCGGCGCAGCTCCACGCGTTAACCAGTTCTGCAGGAATGCCAACCGTGCCAAGAAGTCGGTGACCCAGCTGCCGAGCGGTTTGAGCGACGGGTACGC
CACCGCTGACCAGCGTGCAGGTACGTGGCCGTTTACCATACTATTGCCCATAGCTTCGAGCTCGGCAGACATGACCACCAGCCCCTTGATAGCCTTCTGA
ATTTCCACTAATGAGACTTGCAGCAGGGCCAACAACCGATTGAAGCGTCCGAGCTCCTGCGTCAGGACAGTGTTCATCGACTCCGAATAGCACACAGGGA
ATGCCAGTTCTGCTTTCTCGATATCAAACAGAGGGGGCAGCTTAGCCGCGATATCGCGCGCTGTTTCGTCCAGTACATCGTCCCAAGACTTGACTGCGCC
TCCTCCACCCCCAGAAGCACCACGTGGCTGCAATGACAAGGCCGATTCAAGCAGCAAATTCGTTTCGGCGATAGCGGTGGAGATGTTGGCGTTGTCGTGC
AAGCCGAAGACTTCCGGGCCTTCGTTCATGGGGAGCAGGTCGATATAGTTCAGGAAAACGGACAGGGGGCCCTCCGCCGATGGCGCGAAGTACAGACCCG
AAGGCGAGAAAGTATAGCTGTCCGAGAGGATATCGCGCGTGTAGAAGTCCGAGAGGATCGTGATAAGACACCTTCGATCCTTGTCGTCTGTCACACGGCC
GCCGTAGTTGCACTCGCCTGCAAGGTACGCCAACGCAGCGTACGGAATGGGGTCATCCGTCTGCAGATCATCCAGAGAAATCTTGAGTTGGTCTTTGGAG
ATGGCCAAATCCGACGAGGAGAACACGTAGCTGATGTTCCAGCCCAATGGCCCAAACTTCGTCCGCTCACGCACCACAGCGTGGAAGAAGCAGAGGCCAA
AGAGCAGCTTCTTGAACTCACGTGGCCGTCGGCAGCTAGCCACCCACCCCTCGTCGATAGTCAAGTAGGACCCCTTGAGGTTTGCCCGCATACCCTTCGG
AGGCTCGTTGGTCATTTTCACTCCGTGCTGAAGAATGTACGACGGGAAGGCGCGTGTTGGCTCGCTTGTCAACCACAACCGGAAGCTCGCATGCACACGA
TCCGGTGTAATCTCTTCGCAAATCTTCTCAAGCGTAGGCAGCCAACTCACTGACAAGTGACAGTTCTGCAAGCACACCCACGTTCCGTTATCAATGGCCT
CAGCGATAGCGTTCTCAGCGAGAGGTCCCTGGCCCTGGCCCAGCGAAATGGCCACGAATTTCTTGTTGAACCCCAGCTCAGCAGCCAGCTTGAGCAGCTC
CGACATCGGGTCTGCCCCCGGCGTGAGCACGAAAATTAGCGGCGTTGAACAGTTCGAGTCGTCGAATCCCGCCTTCAGGTCAAACGGCTGCGGCTCAATG
AAGCGCTGCCCCATTTCGGTCGCCACGAAAGACATCACGGCCGGAATCACCTTGTCCGGTCTCAAGCAGCGCAGCACAATGATCCGCTGGAACGAATCCA
GCGAAGCCACGGAAGAGATGTCCATCAAAGTCTCCGCTGGATCGGTTGAGTTGTAAGACGCCTCCCAGAGCTCCAGATCACTCGCGAGCACATCGCTAAA
ATTTGTGAACGAAGGTAGCGCATCCAGCCCGACGATATTGGCCCACGTCTTATCATTGAGCCAGCCTTCGGAGCCTGAAGGCTTTGGCTTCTGCAAGTCC
ATCTGCGTGTTGCCCGTAAAGAAGTAGCGTAGCTCACCGCTGTCAATCGTGCCGTTCCCCACGAGGATCTTGATCGCCAACAAGAAAGCGAACAGCAGTT
TATCCTTCTCGAAAAGAGAGCGACACACGTTTTGGTACAAAATGAACGTGAAGGCGTCGTTCAGATGGCCGAGCCGAGTTGCAAGGACAGACGCGCTCTC
AGCTCGGCCGATTGAGAACACGAAGAGGTTGATGAACCACTCGAGTGCGTATTGGTACATCGGGTCGATCACTGTGAGGTCGGCGATGCAGAAGAAAAGC
TGAGACGCTCGGAAGGCCACGGGCAAGTAGCCCTGGCGCTTTTCAGCGATCATCTGCTGCGTCACTGCAGCCTCACGAACCTTCTCCTCGATCTTGTTAG
CCGTGATTTTGGACGCACCGAGCGTCTCGATCAACCGTTCGTCATCCAGAATGTTACCCTTGGCAGTCTGGAGCAGATACAGGATTTGATCTTCGATCTC
TTTCAGTGTCTTCTTGTTAGCTGCATCCTCGAGCACCAACTTCTCCCGCTGCTGCTCCAGCACAGGCTCCTCCTTAGCAACTACGATTCCCAGCATCTGG
TCTTGCAGGCCTTCCTCGGTAGCCATGAAATTCAACAGATTGACCTTCACACAAGTCTCCGGCGGGTAGTGTGGGTTGCGCAGCTTGGTTGTCATGTACA
GGCGGAAGTTGGCGTCGTACTCCACAGTATTGTCACCCAGGCGAATAGTAGCCACCCCACCAGTCTTCACGACTTGCTTCAGTAGAACAGGCTCTAGCAT
CGGGTCGATTTCTTCCGGCATATTCTCGATCAGCACAGCGGCGCCGATCATGATCGAGTTCTCCAGCATGCGCACGAACCCCGCTTGGGACTGCTTAACC
ACTTTGAGATTGTTGCTCTCCTCCATGTTCTTCACCCATCGGTTAGCCTGGCCTTGCGGGTCAATCATTAACGGCCACCGATTGCTACGCTGCAGCATGA
TAGCATTGTCAATCGAGAAGGAATCGTTCGGGAGCTTTGCAATCGTCCACGCGCGGATTTGGACGGCTTCGCCCAGCGTATCCGTGAGTGTAAACGTTTT
CGAACACGTGATTGCCTGCTTGGTGAGCTCGGTACACCACTGATCCACAGCACGCTCACGGTAAATACTTGTAAACGCGCCAAGGTAGGCGATCACACCG
GAGGCCAGCATGATATCGCCCACGACATTGTCGTACAATCTGCAGTTGGGCAGACATATCACCCCAACGAGCTTTCTCGCCTCCCAGGCCACCGATAAGC
TGCGTAGCTCGCGTAAGTTTCTTGGAGCAGTCATCGACTTGGAACTCGAGGTCGCTCTTCTTCTTGTAAGCAGCAGCCAGGTCCTCTTCCAGCCTGGCCA
CCTTGTCGAGCACCACCTGCAGTGCGTCTTGCTTGACTTTGAGCTCGCTTTGAGCCTTCTCAAGTGCTAAAGTAGCTGCCTTAAGTGCTTCACGCTTGGG
CGCCACCACCTTTGCTACTCGATCGTACAACCACCATAGCGTGCACCCAACTACAAAGACCCGAGGCTGCGACAGAGGCCTTACGGATCTTGTCGGCCTG
GAAGTCTGGATTCGCGGCGTATGGACGCACCTTATCCATCGCCTCCACTGGGATGTTGTCCTTGTCGTACTCCAACAAGTTCTGCAGAAAGCGGGTGTCG
CCTAGCAGCGATTTCTGCGCCGGTCCCCAGTAGTCATCCACCTTCTTCGTGCCCCCTGCTGGATCCTTCACCTTCACTGGGGGTACGCGCATCATGATGC
ACACAGCTTCCATCACCAGCTTGACACCATCAGGAGGCTTCTTCATAGCCTTGATCTCGGTGATGTCGCCTTTCGTAAGAGTCTGCAGCGCCTTGACAGC
GTTCTCGAGCGCTGGAATGGCTTCTGCTAGCTCCGCCTCACAGCTTTCCTTGATACCATTGGCCTCAGCTGCTTGTTCGTTACACAGTTTTTCCTCAGCA
CCAACGATGTCTTTCGTAACATTCGCCTCCTTCTGCTCACGTGAAATGGTCTCCAGCAACGCATCAGTCTCGATAGTGGCCACCTTCAAAAGCGGCTGCA
GTGCCTCCAGCTCGATCTGCATCTTCTCCACCTGCTCGGCCGTCTCCATGAGCTTCGTAAGTCCGTTATCATACCGCTGCTTCATAGTCATCACCTCGAC
GCGCTTGTTATTCAGCAGCTTCTTGAACGTGTTGAGCAGCTCGAGATACGAAGTGGGGGTGACGTAGTAGTACCGACGCTGCGACTGTAAGAAGTCCTTC
GTAAGCGCGCTCACACTCTCCTGCATCCCAACGCACACGTCCACGATGCCAACCTTCACCTGAGCCGGCAGTTCAATGTCAACCAGAAGTAGTCGGCCAC
GGAGCGAAGTGCTTCGTCCGGCCACTCGGCAAACCAATCGATGGTACAGCAATTCACGAGAGACGGGAACATGCGCAGTCGGCGACGGAAAGCCTCTCCA
ATAGGCGACAGCGCCAGCACAACATGCAAGTTGGTCCGACAACGACCCACAAAGAAATTGTACAGCTCGGCACTGTTTCCAGCATTAACCCCTGAAGCTG
TGGCCGCAGGTTCCAGCGCCTCGTTCATCTGCACCAGTTCGTCATTGGCCCAAAGGTTTGCCACCTCGCCAGTGTTCAACAGTCCGTTGATGTCCTCCAG
GTAGGCCTCTTCCACGATCTGCGTGTCTGAAAACAGGAAGACCGTCGGCTGATTGTTCAGCCCGCTGAGTTGCAGCACCTTCTTGATATCGTTGCGCCAT
TCGGTTCTCGAGTACGACTTGGAGATCTCAATCTGAAAGAGTTTGTACTCGGCCATGAACACGGCCAGAGTTGTAAGACTCTTGCGACCAGAGCCGCCGA
CGCCGACAAGCAAGGCATTCCCCAGCGGCTGGTGAATCACGCGTGAAATACGCGCAACGTGCTCAATAGCGTTCTGGAACAGCACGAGCCGCATGGGTGC
GGCACTCATGTTGTTGTAGTCTTCCAGGAACACCTGCATGGCATTCTGCAGCTTTTCGCGGTCACGGAGCTCGGCATAGCTCCTGTTGCCATGTTTGCCG
TCACCTGCTCCACCAAAGTTCCCGTAGATCAGCGTGGGGTTCGGGCCCCGCACATCCGTCGACGTGTATTGCAGGTCGAAGTGCAGCTTCACCGTTTTGG
CAAGGATGTCGGCAAACCAAGCGCGATCTTTATCGTCGATAAGGCGATCAGAGAACACTCGCAGACATTCGTGACTCCACAGACGCACAAAGTCCTTGCC
ATCCTTGATGGTGTCACTTGACGCCTGCGCGACGCCCTGGAAAACCTTGGACAAGTCGCGCAAGTTGAAAGTGTAGTGACTTGGCCGGAGTGGGCAGCAG
AGCCTGCGAGATCGTGTTGTAAATGTCGATTGTGGCACTAACGACTGCACCTCCGAGCTGCTTGACACCTTGCGAGAAGTTGAGCAAGAACCAGTCGGTG
ATCCGAGTGAAGATGGCTCTGAGGGAATCGTTGTCGAACGGCACGAAGTTGATGAGGTTGAAATACCGCACATATCGCTGCGTGATGCGAGTGCGACCAC
CGCCAGGGGGGCCCATTGCCGCGATAAACTGGATATCCACGAGCTGCGTGAACGAGTTGTCCTTGCGGTTGTACCAGCCTCCGTGACCCATCCACTGACG
CAGGATCTCGATCGGTGGCTGAGCACCGTACGTCTCTTTGGCAGGCATATTGAGGTCATCAACGAAAACCACGCAGCTTTGACCCAGTGGCGGGCCCAGC
ACACCCTTGCGTCGTTTGTCTAGCTTGGCCTCAATCAGATCTTGAGTCTGGTTGGCACTTGTCTGCGCTGAGAAATTGAGGAATATGGACGGCGCAAACT
TGGGTGCTGCGTCACTGGTACCTGGCGGGTCATTCAGCCCGCTCAGTAGCTTCTTCTTGATAGACACGGACTTACCTGTGCCTGTATCACCAGTGCAGAG
CACATGGAAGTGGTGACGTATGAGGGTGTCTAGCAGCCACGCGTTGCGCTCGGAATCAATTGTAGGCACCAAAACTTGCGTGAATTGGGCGTCTCTGGGG
ATCACGAACGACCCACCACCTGAAGCTTCCATCCAGTTGACCCAGACACTGCGTCGTGTATCAAAACGGTAGTCGTACACAAGTCCTTCTTCTGGGATCG
ACAGCATGGCAGCTCGGTCAGGGAGGAGCACGTACGACGGAGATTTGGCAACGAAGTCTTTGAAGTAGAGTAGTGAAGGTGAGACTGGCACCCCCAATTC
ATCGTCACCCGGCTCCTCGCTTTCCTCCGTACGCACATCGGCAGTGACAATAGCCACTGCTAGCTCAGCTGAGAGGAAGTCGCGCATGTACCGGTCAAAA
CTGCGGCGCGACTTGGTGTCGACGCAGGCGCCGATAGACCAAACGACAGCTTTAATGAGCACACACTCTAGAATACGCTGTGCATCGGCCTCAGCGGGCA
CAGACGAAGAGGATGCAGTGGGGGCAGTGCCGTCAGTTGGGGGGTCAGGGAAACCATCGCGGAGAGCGCACTCAAAAAGACGCAGTAGTGAGGCTGCGTG
CTCCAGGAAAGTCACCGGTGTTGGCACCGTGCAGTGCTTGTCGACAAAGTACAGCATCGGCGGCACAATCCAGCGGAAGGATTCCTCGAGATACTCGCCA
TGAGACGCGAAAGCCACAGGCAAACGAGTGTTCAGCCACGTCCGCACAAGAACCTCCCATCCCAGCACCTTTGCCTCGAGGAAAACCATGCCGACACGGG
AGACCGTAGCAGGTGATGCCTCTTCCAGATCTTCCGTCTCGAACACCATCCGCATACGGTCCGTCATCTTGACGATCTCCCCGCTCATGAGGCAAAGCTT
CTTGTTGTCGTCTAGCACGGTGTTCATATTCTCGATCCAGACGGCGTCCACTGGGCCATCGAACATGACCCACTGCAGCTCCGGACTTGTGTCGCGAGCA
CAATTACGATACGTGCATGCCAGCACACCATCAGACCACTCGTGCGTGTTTTCATCAAAGTTCCCATAGAGCTGGCCGCTCGTGATAGCCTTCGGGTTCA
TCGTGTGAATATTCACGCGCTGTTGCAACGTTGCAGCTCCTTTGGTGCCGTTTCCTTCCTGCAGCTCGATTTCTTCTTCGTAACACGATGTCATGGCCGT
TGCCAGGGAGTGCACCACGCACGTCTTGCCTGAACCAGTCGTACCGACAATCATGAGGCCGTGTCGGACTTGCACCGTCTCGTAGAACTGCACCACCTTC
ATTTTGAATTCAGGTTTGCACTCAAGCGGAACGTTCACATCCGGTACGATAGCTATGCCACGCACACAGGTCTCGTCGATATGGCGCAGAAGCGCCCCAT
GATCTGGAAGTGGCAGCAGCACGTCGGGGAACAAGTCGGAAGTAATGCCGCGGAAAAGAGGCAAGTCGTCCGTGGTGAACTTGGGAAGATTCACGTCTTG
TACAGAGCGCAGCACAATCTTGTCCTCCGTCCAGAACGGATCGTTGCCGAGCTGTTGTCGCAACGCACCGGTGGCCACGAGAATGGAGTTAACTGCTCGC
ATCCCGTAGTCGTAGTGCTTCTGTGACGATAGCTGCTCCGAAGCTAACTGTAACACCTGTGTGAGCTTGCGAGCGTTGCTCCGAGCCTGAGAGAAACCAA
AGGAATACAGTCGAATTTCAGAGATCAGCGCGTAGTCGGGCACCATCATAGCGCACGGACGGAACAACGCCTTGAGGTTGTCAGGTAGCTCAGCACGCCC
TGCATAACCAGGATTCATCGTGATGAACACGTTGGCGCTAGCATTGAGCTTGATGAAGGTCCCTTCAAACAGGAATTTGTCCACGCCCGCCTTCTTGCCC
TCGTTAATCGTCAGAATCTGCTGAGCAATGACGGACAGCACCTCGATGTTGATTCGATTGAATTCATCAAAGCAACACCAGGAGCCACAGCCGGCCAACC
CCTTGAAGAACTTTGCCATAGCAAGGTAGTCCAGACCATCGGAGCAGTTAAACACCACGCACTGAATGGCGATCGCTTTACTCAGGTCCTTCACGGTCTC
CGTTTTGCCGGTGCCTGCGGGCCCCTCAGGCGCACCACCATACATCAAATCCACAGCTCCCATCATTGTACGATAACACCTATCTGTAAGCGGTGTGATC
ACAAGACGCATCGTGTTTCCGAGATATTCGTATCCGTACCGGACTCGGGCATTCACAATCCGCGCTTGCAAATCAAACGCACCAGCAGATTTGACACCGT
CCGCCCAGTAGTACCGTAGCTGAGAGATCCACTCGAAATCCTGGTCGCTTTCCACGTCCTTCTCGATCATGTGAGAGATCGTGTCGCGTGCGTGGACATC
AATTACCACCAGCGCACCAATTGTCGTACGCTCCAGCTTGGTCAGATTGCCGCGTACCAGCATCACAATCTTGTCCAGTTGCGAGTTAAGCACCTCGATG
TAAGTTTTGATTCCATTTACACCGTTCCCGAGGTTAAGCGCTCGGGTAACATCCTGCGTCCAGTAGACCTGTGATACTGCCAACACAACTTGTGCAGGCC
ACTTGAGCATCCAGGATTCGCGCTCTTCAAGCAGATAAGCTGCAAGAGAACGCTCAGTTTGATCTCGCACGCTGTCCCACTGACTCTGTTCCACCTCGAG
CAGCCACATCTCCACGTTGCCTTTGTTCTTATTGCTTTCTGGGCCCACGGGCAGTCGCAAGGGCACGACTTCACCTTCTGCCGACCGCATTTCAGTAATT
AACAGGGGGGGTCCGTCTTGGAACGTCACGTTGAACACGCCCTCGAAGCACTTGCCCAAATGTGGCTGCACTGCACGCGGTTCCTTGGTCTGCGACAGAA
TTTCTAGCAGCTCGTCGTTCGACAAGAAGAAAAAGCGTGGGAAGTGCAGTCGCTTCATCTCGAGATAGTCGTTCAGACCCTTTTGAATCTCGTCCAGCTT
CTCGTTGGCACGCTGGAACTTCGCTAGCAGCTTATCCATTGCGATAACAGTAAGAAAGGTTGGGTCGGCTACCGTGTCCTCCATTGTTTTGCGCCACAGC
GCATCCACGCTAGCAAAGCGACGCGCCTCCGTTGGCATTTGACGCATAATGTCCTCAGAACTGAAAATTGCTTCGAGATACAGCCACGTACGTTGACATG
CCATCCACTCGTCCAGCAATTGCTGCGAGTACTGCAACTTCTTCTCCCATGCCTTGCAGTCTTTCTCGATGCTCTTGATATACGGAGACCCACGCATCGT
TTGCGTCTTCACGAGGTGGTCGTCCAGTAGTGCCACAATATCGTCGGTACTGCGTAG