Description :
From Genome Similarity Track
Location :
Scaffold_632:488- 2364
Sequence
1876 bases(100 bases per row)
GCCTTCAGCTTTGGACACATGTACCACCGCGAACAACCGATAGGGCGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGA
AATGGTCCATAACACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATCG
CGGTTTCGTTATGACGATCCGCTCGGTCTTGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACCT
CCATCTTTTGGGATCGCGATCGCGGGGTTTGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGGC
GTTTCTCCGCGGACTCGATGTTGCGCTGTATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATTT
TGATCAATCGTGTCAGAGTTTGAACCTTGCGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGTT
GAACGCTCGGAAGAAATCGGACATAAATCCTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTCT
TCGATCGTCTGTGCAGTTTGTGACGAGCTCGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATCG
TGGTAGAGACAGAATGTGATTCATGGCCAAAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCGG
TTTCACAATTGACGCACTCGCCTATATAGCGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTCC
TTGGTGCCCGCCGTCCAACCTAGTATGGTAATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCTT
TTTGCTGCTGCCCTAGGACAGGAAAATGAAAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGCA
TGGCTATATCCCCAATCAGATACGCTTTCAAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTTC
TTCTTGCAAAACTGCCGGGTAACATCGTCTTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGAGACAGGCTTGTCTCGGTATCAGTAACTCATTCA
ACCGATTAAGCGTCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTG
GTTCCAGTCCCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAA
TCAATTTCGCCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACCCTTTAGCCTGATTAGCCAGTAAATCAAACCAAGCAATAG
CCCACGGTATTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAATATCGCACTGTAG
GCGACGCCCTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGGTTCGTCTGCTTCGACCGTGGGTGG