Description :
From Genome Similarity Track
Location :
Scaffold_19:488- 1801
Transcript NameFunction/comments
Phymu_g1277hypothetical protein

Sequence
1313 bases(100 bases per row)
TCCTTGCAGATTGTGTTGAGGCGACAAACAACACTGCAGCGGCCTTTGCccttcttgaactcttcCTCCTTGATGGTGCCAGGAGACTTTTTCTTCTGTT
GCCTGACTTGAGTCTTCTTGTTCTTTTGCGTGACTTTCTTCGACTCTTTCCGTTGCTTGGGTGGAGGCTTCTTCGAGTTCCGTGTTTGAGCTGGGGCCTC
GGTCACAGTGAGATCCAGCAAGTCCTGGCTCAACTCGTTCATGTTGTCTTCGTCAGAGTCCTGCGTCTCGGCGACGGTCTCGAACGGAAGAGGGATGTCG
TCCGGGTCTTGAGTTTCTTCGACGATATCCCAGTCGTTCGGATACTCtgtcttcttgcgcttgcgcCTCATGGTGCGAATGAGGGAATGACAAGAAGTTC
TCCAGCCGGCTTCGAAAAATTTCATATCAATGTTTGTATGCCCAAGTGCAACAAATCTCAGCCAATGACCGAGCACTTGGTGGACATGCTTCTGCAGATA
GCGGGTACGAGACCCCGAATCGCGGTCTGGATGCTCGCTTGTAGCGCATTCAATGACCGTGGACCGTTTTGGTTTACTTGCTTGCGAATGAAGTTGAAAC
AAAGCTCGACAGGGTTCAGTTGGGGCGAATAGGGCGGAAGGTATGTCAAGGTGACTAGGGCTGGTGTCTGCCCGCGACGACTTTGTCAACAAATTGCTCA
ACTTGCTGGTGACTCAGACAGCAACAAACGTGGGAAAGGGCCAGGCAGTGACGAATGTGCTGGAAGACTTGATGAAGTTCTCGTTATCTCAATACGACCG
ACTGACTATGCGGTCTCTGAAAGACATCAATGCATCCGAAGATTCTATCGTCGCCACGTTTGACGATCGACTGCTCGAGCAGAATTTGGAACGTAATTCG
ACGAGAGCCATTCGTCGTGAAATGGGCCAATCCCTTCGACGCTGGCAATACAAGTGTCGGGATCAAGGGGAAACTCCAGTTTACAAAGTTACGGGAAGAT
GGCGGGGGAACTTTACACGGTGTTCGGCCTTCACGTTGGAACTGAATTGGATTAAGAAGGCAGCTCTGCCTTCTTACTGCGCGACTACGAGGATTATGAA
TCCTGGTGCAAATCCTGATCTGGTGTACGAACACTAGCAGATTTGGTGTCGCCTACTGAAGCTACCAGTgtatgaagaagaaaaagaaaaaaagaagtaa
aacaagaagaaacaggaaAAAAAGATAAAAGCAAAAAAATAAAGCTCGGCTTGTGCTGGGTGAAAAAGAATTTTTCAGTGACCCCTGCCGTTTTTAGGAA
TGGCAATATCGTA