Description :
From Genome Similarity Track
Location :
Scaffold_366:488- 1663
Transcript NameFunction/comments
Phyag_g5093transmembrane protein, putative

Sequence
1175 bases(100 bases per row)
TCCAGCAGATGCAAGTAgttggcctgcagcggcgtcgactTGCTGAGCACCAACTCGGTCTGTGCGAGTTGCTCCCTTGCCTGGCGCAGCTCCTCTGTGA
GCGCGTCGTACCGCTCCTTGTCAAGCTTTGACTTGGCCATCTGTCGACGAAGGCGTCGGGTGTACACATAGTGGTAGATGTTCTCGTATTCGTATTCCTG
GTTCGTGATGCTCCACCAGGCATATCCGATGATAGAGACGCCGAAACCAGTGAAATACGTTACGGGCTCCATGATATCCCACGAAAAGTGGATAAACGAC
AACCAGAAGTACAGTCCAAAGGCTCCGACGAGGGACGTCGACAATCCATACGCGATGATGTTCGCCTgccgcgtcgccgtcgcctccAATTCACGACGCA
AGTTGACGAGCGCCACATGCTCCGGTTCCAAAGCTTGAATCTTGGCGAGCAGCGCAtctcgctgctgttgaaagAGCTGCGACGACAGCGGTGAGAGTCC
AATAGACTCCAAGTACGAGTCGAGGATGCTGCGGGGTTGCAAAAACACCGAGTGAGTcaagtcttcgtcgtccgactTGCCAAAGTAGAACACGACGCCC
GTCTGGTGGAAAGCCCGCAGCACTTCGGGCGCCTGTTTCTTGGGGATGCCTCTCTCCTGACACATTTGCATGAACTCTGGGTGGCTGATCTTCCACTTGC
CCAGTCTCTCCAGGTCGCTGCGTAACATAATAATTGCCGCTTTCTGCGCCACCGAACGCACGTCCAAGTCCCCATCATCGGCCAGGCTCTGGTATGCGCT
GCCCGTGAACACTGGGGCCCTCACAGGCAGCACTTGGTCGTTCAGCAACAGCTCAAAGTCGTCCGTCAAAACCTGCTGCAAAGTGTCCTCAGGCTGGAAC
TCTTCTCCTCTGGCCGAGCGGATGGCTACACTCTGCACCGACTTGTCCTCCGCTTCAATCTGGGCGATGATATCAGCCACCGTGGTCTCTGTAGTTCGTT
GGTTCGTTAGCATATAGAATATTAGATAATATACTTTATAGGTGACAATTCGTAATAAACTATATAATAACTAGCCTGGTGGAATACTGAAAACCCGTTC
CTCGTCGAAGCCGTTTAAAGGCAGAGGGACTGCCAGAGTGCATGTCCCGTCGTGGTATTTCAGCTCAATAGCGCG