Description :
From Genome Similarity Track
Location :
Scaffold_485:488- 1491
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_485-snap-gene-0.8Glucan 1,3-beta-glucosidase

Sequence
1003 bases(100 bases per row)
GCACTTGCGCTCACACTTTGCTGCGTCGCGTTGCTCTCCCGCAACGCGGGCGCGCTCAACCTCAAGCTCAAGGGCGTGAACTACGACTTCCGCGAGGGGC
CGGACTGGGACATGAACCGCTGCAAGCCGTCGGCCAAGATCGGCAAGGAGCTCAAGTTGCTGGCCATGATCACGCCGCGCGTGCGCATCTACTCGGTCTC
GGACTGCAACGTGCGGCCGGTGCTCAAGTACGCCAAGCAGTACAACCTGAGCGTCTGGATGGGCGTCTGGGTGGGCAACACGACCAAGATCTTCGACAAG
GAGCTCAAGACGCTCACGACGCTCGTGAGCGAGGGCGTGATTGACAGCAAGCTGGTCGTCGGCGTGAACGTCGGCAGCGAGGCGCTCTACCGCAACGACT
CGACACCTGAGCAGCTTATTGCCAATATGAAGAGCGTCAAGGAGCTCTTCGCCGCCAACAACCTGAGCAGCATCCCGCTCTCGATCACGGACACGCTGGG
CGAGCTGATGGACAACCCGAAAGTGATCAACGCCATGGACATCGTGTCGTTCAACATCTTCCCGTTCTGGGGCAAGGTCCCGGTCAACGATTCGATGAAG
AATCTGAATGAGAGCATCGCGCCGTACCTAGAGACTGCAGGCAGCAAGCAGTTCGTGATCACGGAGACCGGCTGGGCGTACAACGGGAATGACCGGCGCG
CATCCAAGGCGAGCTCAGAGAATGCAGCGGTGAGTTTTTGATGATGCTGTTAGGAAACTTGTTGTCGACTTCGCTAACCTCCTAATTGGTCTATCCTGAT
CTGTCAACAGCAATACCTGAACGACTTCTTTCTACTGGCGGAGCGCAACAACTGGATGTACTACTACTTCAGCGGCTTCGACACACCGTACCGCATGGAG
GTGGAGAACAACCTCAACACGGTCGAGGCGTACTTTGGGCTCTTCAGCTTCGGCGGCAAGCTCAACAAGCCCTACGAGAAGCTCGTGATCAACGGCACGA
ACG