Description :
From Genome Similarity Track
Location :
Scaffold_2:48792- 60837
Transcript NameFunction/comments
Phypa_INRA-310PPTG_02082hypothetical protein
Phypa_INRA-310PPTG_02083kinesin-like protein
Phypa_INRA-310PPTG_02084hypothetical protein
Phypa_INRA-310PPTG_02085hypothetical protein
Phypa_INRA-310PPTG_02086carbohydrate-binding protein
Phypa_INRA-310PPTG_02087carbohydrate-binding protein
Phypa_INRA-310PPTG_02088hypothetical protein
Phypa_INRA-310PPTG_02089phosphatidylserine decarboxylase

Sequence
12045 bases(100 bases per row)
AGATTTGGATTTTAATAAGTACTTCCCCTTGTTTGTGGACGGCATGCGCGAGAAAACGTTCCCATTCAGCTTTTTGGCCCGTGAAGGTGCCTTTCAGCTA
GCTGCTTTTGCCCAGCGATACCCTAACAAACTCATCGACTGTTTGCACCGTGTGATTCCGGCACTTCGCACAAACTTGGAGACCCGTGACGATGGAGCAT
TGCGAGATGCGCTGCTATTGTTACAACAGATCACGCAGACGGCAGGTGTGGGCCCGTTGCTGGTACCTTATTACCGGCAAATGCTGCCAATTCTGAACCT
TTTCAAAAGCAAACGACGAAATCTCGGGGATGAGATCGATTTTCGACAGCAACGCTCACAAGATCTCGGCGAGGTGATCATGGAAACGCTTGAGATGCTT
GAACGAACAGGAGGCGATGACGCGTTTATCAACATAAAGTATATGGTTCCAACGTACGAAAGTGCGTTAAGCTGACAGCGATAAACTACTAAAACACGGT
AGAATTAGTTTTCTTTCGGTAAGCTTTTATAATGACGCGCCCATCACATGCTCTCGTCTTCTACAGGTACTGGTACAAGTGTTGGCTGCAATTTGTCAAG
TTCAGCTTGGTGACGTTTGTGGATGCGCTGAATCTCGTCTTCGCATTCTTTTACCTTTTCACGCAACTCCTGTACATGAGCACGCAGCTTCTCAGTTTCT
TCCGCATGCTGACGCTCGCGCTTTTTACGTGCAGAGGGTAGATCCTCGCGCTGTATGCGAGACATACTTTGATACTGAGCACGGATCTGCTGTAACTGCT
CCCGCATTTCGTTGCCGATTTCTTCGCGAATACGAACCTCCATCTGCATCTTTTCAGCTTGGATCTGTGTTAATTGCTGTCGGAGTTCCTCATTCTCCAG
CTCCAGTTTGGCCTGTACATGTATTCCATAATTTCTGTAAGCAACACCATCGACAATAGACAAAAGACTGACTACGTACCCAATGCAGATTTCTCTCGGC
GACCTCTCTTTGTGACTCCATTGGTGACGTCGCTACTTCTGCTGTTGTCGGCTTCGCTACTGGAGCTGCGAGCGAGCGATGCCGACGGCGAGCAGAGTCA
CTCTTTCGACGCTTGACCTTAGGCCTGGGCGGTGATGAAGCAGTAGCTGCTACCCCTCGATCCACGGGTGCTTTCGATGCTTGTGTTTCGAGTGCTTCCA
TCAACTGCCGCTTTCTCTTCTTCAATCGACCATCCAGGTCGTAAAACGTAGCTGTCGGAGCAGCTTTCCTAGGGATGGATGTTCGTGTCCTCACTAACTC
CCGTGCAACGGCGCTGTATTTCAAAGTACGCAAAGTCTCGTCAAACTCATGGCTGGATGGATTCACTGCCACAATCATCACCAGGGGACCGTGATCGTTG
CCCACAAGATTCTCCTGAAAAAGTCGCGCTAGCTTGGACTCACGGAACGGGACCATCTTTTGTAAGCTCGGCGGGTGTTGCTGGTTCCACCTCAAAGTCT
CCAGACAACGCATCAGGTTCATCAACGAACCATTAATCTTGCTGGCCTCCTGCATACGTAGCCCCGTTGCACCGCTCTTGGAGCCTCGTTCAGACCCTGC
CAGATCAACGATCGACACCTTACTGCGCAGCTCCGAAGAGAAGCGCGATGTCTGGTGATACAAATGAAGCGTGAAGACGCAGTGACTACGACTTGAGTCC
GAGTTGTAGTTGGTCTCGGCCACCTGCTTATGTCGTCGACCCATTTCCAGCAGCTCCAGACCTTCCTCCAGCGTTTTAATGGGTTTCTCTACAGCTCCTC
GGACCTGAATTTTGCCGTCGCAGTCCTGTACACGTAGCGCTCTTCTCTTCCGAATTGCAGGTGACAACAAGTCGAACACGTTCTCGTTGTAGATCTCAAG
GTATGTGGCTGTCACTTTCGTTATCAGTTGTTTGTCGCCCTCCTTGCGCTTGGGTAGCTCGTCCATCACGTACTGTAATGCCTGTGGCAGCACACCGGGC
GCTTCACTCGATCCACTGATCGTATACGTCTTGCCTGAATTGGTTACTCCGTAGGCAAAGACGAGGCCGCTCTTTCCGTCGAAGGCCGCGTCCAGCACGG
GTCTCGTAGTGGCCTCAAACAGCTCCGTCTGCTGTGTCTCTTGACGGAAAATGCGCGAGAATTGGAAGCTCGTGGCCGTCCCAGTCGAGCGATAGGATTG
CGACGTCTTAGGCGGTTGAGCCAGTAGCGACACGTCCGACAACACCCGAAAACAGTCGGGCTCCGTCTCGTTAGAGGCCGCTTCGAGCGGTCTGAGACGA
ATAACGATCTGCACCTTGTTGGTATCCATCTTGGCCTCCTGCTGCTGTTCCAGCTCCTGCTCTGTGCCGTCGCCTTGCTGTTCCTCTTCTTCTACCTCTT
GTTCGTCCATGATAGCACCGCTGAAGCTGAGTTTGCGTACAATGGTACCCACTTCTTTTGCGGCGAGCGACGGTGTATCACTCGTTCTAGTGCTGCCGTT
GTGCGCCTGGCTAACGTCCTCCCCAGACGCAGCCATTATAAAGTACAACGAGAAAGTGCGCGAATATTCAAATTGAGGATTCATAACATGGTACTTTAAC
TCGATATAGTGACACGTCAGTGAAATCTTAAGGGGGTCAAGAGCTGACAGAGACAAAATGACGCTGTCAAGAACGCACACGCTGCTATTCGTGCTTGCCA
CGACGGTGCTTCTTGTGACCTTCGCCTCCGCCGACCCTCGTGAGGTGGAGAACGCTGAGTACGTCTATGTTGAACCCTGCAACTACTGTCCTCGTAGCTT
TACTGTAGCCGTAGATCTGACTGCCCATTCATGTGTCTTTAGACTCAAGGAGGAGTTTGGCGACGATTTCGAGGACGAGCGCTCCATCCCCGCGCTCGGT
GAGCTCGAGCAGCGTCTCAAGTTCGATTTGGAACACCAACTGGCTGCTGGTGCGCCCTTCACACCACGCGGCGTTGTGGAGATCGTGGCCAGCGCTTCGT
CCCCCAAGCCCAAGGTCTCGTTCTCGGCATTACCGACGCTGAGCGCCGACGACGTCGAGAAGATGGAGACACTGCTGCACCAAGATCGCCACTACACTGT
TCGTGCCAAGGCGGACCCGGCCGACCCGGAATCGCCCTACGTCATGACATCCGTGCCCATGTGTATGCTGGCCGCCATGCGTCTACGCGAGGACTTTGCC
TTTCACCTCTCGGATAATGGCAAGCTCGTGGCCATCGAGTACCTCACACCGTACCTGGATAGCGATGCCTGTGCTGAGTTCCAGTCCCGTAGCCTCAGGG
ACGTGCGCTTCGGACCGTTCGGCACAGTTTTGAAGACGCAGGCTGGACCATCGTAAGTGATCATGACATTCTAGTGGGCATACCGATCTGGCTCTGACTC
GTGCGCTTGTTTTGATAACGTAGACCTCCGAAGAACATTGTGGTCAAGCGCGACCGTGCTCCACAAGGCGTCAAACCGGTGAAGAGCGAGGATGGCAACG
ACGAACCCGAAGAGGAAAACCAATCCTTCCTTCGCAGATACGTACGTGCATCAGAAGTCTGTGTCTAGCTAGTATTGTCTGCTGATCTCAGAAACTCACA
TCCATTTTGTGTTTGCTTTCTGTAGTGGTACATTATTTTGCCTATCGTTGTCATGAGCCTGTTCGGTGGCGATGGAGGCGCACCTCCGGCCGGCGGAGCC
GGTGGTGCCCCTGCTGCTGGTGGTGGAAGACGACGATAGATCACTGGACGAGGAACAGAACATGCATGCATTGTGCAGCTTCAGCTCGTTCCACCCACGG
TCAGTAAGGTGTCACAGGTAGCAGAACAGAATCTACATTCCAGACTGATGGTTGATATCTCTGAAGCCTTGCACTTATCATTATACGATCAAGCTGGTAT
GCTCCTCTTCACTCCCTTTTTCCTTCTTCCTCAGCACAGTTCCAGGAGCTGGTGGCCACTCGTGGTTCGTCACCAATCGCCCCCACAGTGTGTGGTCTCC
CGTGGACACCACCACAGCCACAGCCGTTCCTTGCAGAACACTCACCGTCATGGGGATAATATTACCACAGTGCAAAGGATCCTGCTGAATATGCGGCGGT
GGCGTGTCGGTCGTGACGTGTTTCCTGGTGCCTCCCTGTCCGGCTTCCTCGTCTTCTCCGTCGTCGCCCATCAACGTCGTTTGGTCCACTACGCAATCGT
TCGAGCACTCGATGACGCGCAGATCAGCTCCTGCCACATCCCCAGCCTTGAGCTCCACCACGTCTCCGTACACAAGACTCATGGCGTCCATCCGCATTCG
TCGAGTGGCCGGCTGACCCTGCCCTGCAGCAACTCGACGACGCACCGTCGCCTCACGTGGTAGCGCCTCTTGATATGCTTGCATGGAGGCTGTGCGCATG
AGGCACGGCAGTAAACAGCAGACCCAAGACGGGCAGTTCACAGGCGGGGTCACCCGGTTCACACCGTAGAGCTCGCGTCGCGTCATGGCGTCGTCTCGAG
AGAGTCCGAGGGCGGGGTCCACACCCACCTCCGCCACAAAGTCTGCCACATTCGCAGGTCGTTGGTAGTCCTAACACAGGAGGCAACAGAAAGAAGAGGG
TCAGGTGAGTAAAAAGCACGCGTGGTAACGGAGAGCTTCAGTAGATCGGACACCTCGAGCTCTTTCATAGTTCAGATCCGTTTTGCAATCTGATTTTTGT
CAAATCTTATTAGGATTATTAACACTGAACAAAGAAATATACTACAGTAGTACTAAATTGAAGCAAACGGTCTGAAAAACAACACAGCTCAACCTATACC
AGATTCTATAGCAGTCACCATTATATTTCTTAATTGCACGCTGCAATACATGCAAACTCGTCGACAACAACATACAACTGCTTCTTAAAGGTCCTGATGC
TGCTTGAAGCTGTTGGTGGTGGCTCACCTCGTTCACTTCTCCGATCGAAGCTTGCGGTACGCCTTCTGAGAGGTGGAAGTCGTGCCGGCCTTTGCACCAG
CGTTCGCGTTCGCATTCGCAGAGGCGCTTGCAGTAGCACTGGCCGACGCACCACCCGTGCCGGTCGACGTCTTCGCAGTACTGGCTCCACCATCGCTCGT
CACGGTCACAGACTTGCTCGCGCCGGTTCCAGCACTCACATCGACACCGTCGTTAACAACGGTGGTAGGTGCACCGACATGGACACCGTTCACTCCAACA
GCAGGAGAAGCACCCACACCAACACTAGCGACACCCGGAACGCCCACACCAACACCAACGCCATTCACGCCAACTCCAACGCCGTCTACTCCCACGACAC
CAGGTACGCCCACACCAACGCTAGCAACGCCCGGAACGCCGACACTAACGCCTGGACCGACGTATCCGGGGGCACCCACTCCGACGCTAGCCACACCTGG
AACACCCACTCCGACACCGACGCCAGGGACACCGAGTAGTCCGAACGTCTCGGCCACTTGCTGTTCGGCGTGTGCACCACTTGAGAGAGCCACAACGGCG
ATGCAGAGAGCGAAGATCTTGTTGTTGCTAAACATGGTTGTTGAAGAGGAGGCTTGGTCAAATGAAAAGAGTAGAGGTCTTGCTCTTGGGGAAGTTGGTT
CGAGTGGATGAGCTCGAAGGAGTGAAATTGAGAATGGAGGTGAGAGCGGCATGGGCAAGGCTCGAGTGGTTTGCGTGAGGCAAGAGTTATGAGTAGCCGA
TGGAAAAGCATGGGCGGTGTAACTGGCAGCTTAAGCGATCTTCTTGTGACGATACGGAGTCTCATGTGTGTAATTGATAGGTGATAGAGTGAGTCTCTGG
AGTCATGGGGTCCAGTACGGAGGGCACCTGTTGTACACATACACGATCATTTTGGTTGTAGCAGCGCGCTCGTTATCCAGAACGACAAATTTCTTGATCT
CTACATCTTCTTATCCACGTTCCTTGACTTCCATCAATTCAGAAACCAGCCGAGCATTTACGGGCACCATACTGATCGATCCTGTTACATGAAAATGTGA
GTCCAAGTATTGCAGTTCTTATTCAACCGCTTTTATACTGTGTATTGTATGCCCTATGTTGAAGTTGACTAGTGACATGGAGTATGCGCCTGTTCGAATT
GACACTACGATTTGCATCTCGGCTCGTGGCCCCTAGACGATCGCTGCAACCTCTGTTTCAAACCATGTCCTATACTGACTCAGCACCGCCAAGATACGGA
AAAGGTTGGAAATCTCTTTGTTCAATCCATGCAACGCTGGTATTACCAGACCATTCGTATGGATCCCTCTGAGATTCATCATGAAGAATTCTCCCTGAAC
AACTTCACAGCATTTGACTGGTCCCCCACTCAAACCTTCCTTGCAGCAACTCACTCATACATCATTCTCAAATTCACTCCTTCGAGCTCATCCACTCGAA
CCAACTTCCCCAAGAGCAAGACCTCTACTCTTTTCATTTGACCAAGCCTCCTCTTCAACAACCATGTTCAGCAACAACAAGATCTTCGCTCTCTGCATCG
CCGCTGTGGCTCTCTCAAGTGGTGCACACGCCGAACAGCAAGTGGCCGAGACGTTCGGACTACTCGGTGTCCCTGGCGTCGGTGTCGGAGTGGGTGTTCC
AGGTGTGGCTAGCGTCGGAGTGGGTGCCCCCGGATACGTCGGTCCAGGCGTTAGTGTCGGCGTTCCGGGCGTTGCTAGCGTTGGTGTGGGCGTACCTGGT
GTCGTGGGAGTAAACGGCGTTGGAGTTGGCGTGAATGGCGTTGGTGTTGGTGTGGGCGTTCCGGGTGTCGCTAGCGTTGGTGTGGGTGCTGCTCCTGCTG
TTGGAGTGAACGGTGTCCATGTCGGTGCACCTACCACCGTTGTTAACGACGGTGTCGATGTGAGTGCTGGAACCGGCACAAGCAAGACTGTGACCGTGAC
GAGCGATGGTGGAGCCAGTACTGCGAAGACGTCGACCGGCACGGGTGGTGCGTCGGCCAGTGCTACTGCAAGCGCCTCTGCGAATGCGAACGCGAACGCT
GGTGCAAAGGCCGGCACGACTTCCACCTCTCAGAAGGCGTACCGCAAGCTTCGATCGGAGAAGTGAACGAGGTGAGCCACCACCAAAAAAAAAAAGCCAC
CACCAACAGCTTCAAGCAGTACGTGTAGACAACAGCATGCTATGTATCGGTGTCGTTAGTAGTTGCGTTTGCGTGTACAACAATAAAATACGTAGTTCTT
TTGAAGGCTGAAGCAAAACTTGTTGGAATTTTATTTTTTTTCTTCAGATATCCCTAGTGCAGTTTCCCATTGCGATCTAAAGCGAAATTCTACAGGCGAC
CTTTATAACGAGCCCGGTGGATTCTGCTGGATGCTGCCGTCTCTATTTATACGAAGTACTTGTCTAAAAACTTTACGATCGCCATGTAAGGCGAACAAAA
AGTGGATATCGAACGGTTTGTTGGCCAGATTCCTAGTCGTGGAGATGATCAATCTCGAATGAGACATCCGTATCCATGAATCTGGGTACAACATTGGTTT
GGTATTGGTATCATCAGGCCAGGAATCGTACTAAAACGAAAACGTCATGGTGTTGCGGCTGACGAGACAACCAGCGTTCTGGAATTGGTGCGAAAAAAAC
TATCGAGCGCCGCTCGCCAACTACTCCGTTGTCAACGAATTGCAATTCCGAGTCGGGCGAGATGGCGAAGTTGAATACCAATTAGTTGGGGATATGGCAT
CAATGCCACTTGGTATAGTCTATTGTGAATCAGACCTGCGCCGGTAGAGATAAAATACAAAACACAGGAACTCGAAACTCACGCGCACCTTGTTCACCTT
CTTTCTAGATCTTCAGGTCGGATGTGGCACTTCTAGCGCTTACATAAAGTCATCGTAGTCATCGTACGTGTCTTCGTAGCCAGCATACCCCTTACCACCA
GCACCACCGTTGCCAACGTTACGCTCGACATTAGCGTAGCCCTGCTTGCCCGTCTGCTTCTTCTTCTTGCCTTTAGGCTTGGCTGCCGCAATCTTCTCAT
TCTTAATGACATTGACGATTGTTGTGATCTCCTTCATGTCATCAGCCGTCAGGTTCACCGACGCCTTCGTGAGAATCACCTTAATACACTCAAGAGCATA
CTTGGAATTGGACGTAGCCAACCGGGACGACACCACGTCACCCAGGTGCTCGTGGTCGGCGAGTGACAGCAGACGCATGGCTGAGATGGCACTATCCGCG
TCATCAGCAGTGCCGATCGCGGGCTTGGGCGGTGCGCCGGCAAAGGCGTCGATGGCCATCTCGAAGTCCGCCTCCTCGATAGAGGCCTTCTCGCGGGCTC
GACGCTGCTCATCGGTCTCCTCCGCCTGGGCGGCAAGACGTGCCTTGGTGAGGGCGATCTCCATCTTCTGCTTCTCCTCGATCTCCTTGAGCTTCATCTT
CTTAAGCTGTTTGGGCTTGAGCGGGCCCTTGGGGGCGGCCGGCTCGGGCTTGGCGGCCACTACCGGCTCCTCCTCTTCTTCCTCGTCGTCCCAGTTGGCG
GCGACCTTCTGCGTCTCCGTCACCGTCGGCACTTCGAACTCGTCGTCATCTGCAACAGTCAAACAAGGTGGATTGTGAGCGATTCAGAGCGAGTAAGACC
ATACATAGCACTGCGTTGCGCGCGCGAGACGCGGCGCTAGCAAGCGGTACTAGTAGATGCAAATATAAGTTGCAACACGCACCCCAGGAGTCCATCTTGG
CTGGCTGCTGTATTCAATTTGCTTGCGCTTTGGTTGGCGTTTCCGCTTCTCTCCCTGTTCGATTATTGGCCTCCAGACAAGGTGCTGACGCATGCTCATA
TACAAACCTAAATTAGAGCACAAATAGCCTAATTTAGCGTTTTCCACATCAACAACTTATATCGTAATCCCCCTGTTTATTCCTTGCGAGTCTTAGGATA
TCTGTGCTTTTTCCTCACCGCAAGTCGATACATAGCTCATTAGAGCATCATGGTCTCAACCAGCGCCATGTTCCGCAAGGCTCCGCGCCGCGTCAGCCTC
CTCAGGGCGCAGCAGCGTCGCCGATTCTCCCAGCAGCAGCAACAACAGCAGCAGCAGTCTAGCAATGGCGCTGCACCCTCGGGCAGCATCTTCTCTGGCA
GCTGGAAGATCCCTGCCACCATGGGCTTTGCTCTCATCGGATTTTTGCAGTGGCAGCACCTGAACCATCCGACGGATGAGGAGCGCAAGACGCACCCAGC
GCAAGCTTTGCGGCGTCTGCCTGGCGCACACACGGCGTTTGAGGACACGATGGCCACTGAGCGCCAGCTACAGTCGCTCAAGCTCTTCCCGTACCGAGCT
GCAAGTCGCCTCTGGGGTGAAGTGCACGACAAGGAGCTGTACGATCACACCTACTTTTGCACACATCTGCAGCAGATCCTCATACTTTTGTGCTTTATGA
CTGAATGGCAGGCCGTTATGGATGCGCGAACCCGTCTATAAGGCGTGGACTGCCGTCTTCAACTGTAAACTGGACGAGATGAAGTACCCGTTGCAAGACT
ACGCCAACCTCGGCGAATTCTTCTCGCGCCCATTGAAGGAAGGCGCCCGGCCATTCGACACGGCTCCTGGTCATCTCGCCAGTCCGGTGGACGGCACAGT
GGCCTCTATCGGTGTGGTGGACGACTCGACCAACATACCAACACTGGAGCAAATCAAGGGTGCGCGCTACCGACTCGACGAGTTCCTCGGCGATCTCCCC
TCGTTCTTTACTAAAAACCCGTCTGCTTCTAAGGGCAAGAAAATGTTCCACTGTGTTCTGTACCTAGCCCCTGGCGATTACCATCGCATCCACGCTCCGG
TGAACTGGCAGGTCGAGGAGCGCCGTCACTTCCCTGGAAACCTCTTCCCTGTCAACCAAACCGCTGCACGACTGATTCCGAGTCTCTTCGTGGAAAACGA
GCGTGTTGCACTGCTGGGTGAATGGGAGCACGGCTTCTTCTCACTTACTGCGGTTGGCGCCACAAACGTGGGTTCCATTGTCATCACGAAGGAACCAGAA
TTCCGCACCAATACTGCCGCGCAAGACCCACTAGTGGGCCAGTGCATTACGAAGAACTACGGTGGCAAGGTGGACACAACTCGTGGCGAGGAGATGGCAC
AGTTTAAGGTGCGATGGTTTTATAGTTGCAGAGGTTGCGATACGCTAACGAACTCTTGTTGCGCGTACCACGCAGCTGGGCTCCACAGTCGTACTGGTTT
TTGAGGCTCCTGAGTCGTTCCAGTTTACTATTAAACCGGGCGACAAGGTGAGTTATTGACGCTGTTCTTGGCTTGCAACACGGTTATTAACAGTAACTTG
TGCATGTAATCACGCAGTTGATTTTGGGGAAATGCATCGGCAAAGTGGAGTAAATATCCACACCGACAACCTGCTGTGTTGCTGTTGATGTCCAAATGCA
AAGTCAACTCGATGAACTCGTTAATGCGGTTTACCGCTTCTCAATTAGAGCAGCAATTTATGCCTGCGTGTGGCAGTTTGGATACCTAAGCTGCATTACA
GCATTTAATGCCCTGCTTATCCAAGGATCATCACTTGAGCGCTTTTCACCCACTCGACCGTCTAGACGGACTTGCAACGAGGTCAGATACGACAGCCAGG
GAATCAATCCCCGCGACCTCCCCAGGCTCGGCAACTTGGCCATAGGCGTGATCCTGGGAAGCAATCACCACGACTTCCCCAGCCGCGGCAGCTAGGCCAT
AGTCGTGATCCTGGATAGCACCCAGTGCCACGCCGGTTCTCACCATCTTCCGTCGCAAGGGCTTCATCCGCATCATCTTGCCACCAGGTGTGGCTTTCAT
CAATCACTGCCTCAGCATCGTCGGGTACCACCAACTCCGAGAGTCTAGTAGACTGCTCATCATCCGAGAGGCGACGCAAATGCGTGTCTACCAAAGCAAC
ACGTTTCGTCATCACGAGGTTCAGTGTATAAGTCATCATTGAGAAGTTACATCACATCTTCCACTACCTTTCGTTTCCAGCCCGTTGGTGAAAAGCTCAA
CCAAGGCAGCTCCAATCGTAACGACCAGAAGAATCAAACCCTTCATTACGATGTCGATTACCTGGTACTCAAACACCTTTACGGTTTATTGTCTCTCATC
GTAGATAGCAGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN