Description :
From Genome Similarity Track
Location :
Scaffold_10:4879- 6287
Transcript NameFunction/comments
Physo_525656AlNc14C109G6335

Sequence
1408 bases(100 bases per row)
TTTGCGCGGGTCGCAGCTCCACTGTACAACATTCTCGAGTAGGCCATGCAAGCCAGTGGTCATCGAACTAAGCGTCAGCTTTCTAAAGTGCAGCTTTCAA
GTGTTAGATGGGGCGCGCAGAAAGAAGAAAGTCTGGCGCAGGTGAAGGCTCGACTTCTGGCGATGGTGCCTTTGGCCCATCCAAAAGCAGAGTATGATCT
TGCATTGGTGGTGGATGCGAGCCTGGATCACTGGGGATCGGTATTGACACAGATGCCAGCAGAGTTTTCAATTGCGGATTTTGTCCTTGCAGCTACGGCG
ATCAAAGGTGGAAGCAAGCTTTCTCTGCATTGGCGGGGTCCAATACGTGTGGTGCGCTCCCTCAACGATTATACGTTTGAGGTACAGGATATCTGCGCTC
CGTATACAGTCACTGTTCGCCATGCTTCGCGGCTCAAGTTTTACCGTGAGGCTGGCCGAGGCGTCACCGAGGATCTGGTTGCGCACGCTCTTCATGGCGA
AGGGGGTCACCTCGTTGACAAGCTCCTAGATTACAGATTGGGGCAACAAACCCAGCAATGGGAGGTTTTTGTGCAGTGGATTGGACTCGATGCAGAACAA
GCATCATGGGAACTAGCGTCTGTCATCTTTAAACGTTCCGCAGCTTGTTCGTAAGTTTGTGGCCGAGTCCCGACCGGATCACCTGGCGCGTCGCATGTGG
ACGAAGTTATCACCGGATGACCCTATTGAAGACACCGAGCGACGCCAGCCTGATCGCGGTCGTCGAAAAAGGAGGAAGTGACCTGGGTTGTACCCACCCA
GTGAGATGCGAGAAGTAAGATGTCAGTGTGTATCTAGGTTGTAAGTAGTCTGATCGAACTAGGCTGTGGGTTCACTAGGCGTGCATGTGCATGTGTGGGC
TGCTAAGGCGGTCTCCGAGAAGACGAGAGACAAATGATCAGTTTCTATTTTCTCCACAACCCGTTAAGTTGTTGGGATTTGCCGCCGCCGTGTGGAGGCA
GTCGAGGAAGACATCAAATTATACTTTAGGCGGCTTGGCCGCAATAAAGGGAAAAACATTCAGTTTGAGATTCACACAGTTAAGAGTTAAGGGTTGACTC
TTGGAGTCCGTAAGGTGTACGGACTCGTACGTTCTGGTATTAGAACGGGCTATCTTAAGCTGAGACTCTGTGAGTCTGTTACGTCTTTCTCTGACGCTAA
AGCTAGGGCAGCCCCGCTGCACAAGAGCTATTTCAGTTAATGACGGCGTAGATGAATCTGTATAGGCTGACCCTCTGTGGAGGATGGAGCAGTTTGCTCA
CTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGCTGAGCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCCCGATGCGGTGAAC
GCGCGTCT