Description :
From Genome Similarity Track
Location :
Scaffold_291:4878- 6788
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_291-snap-gene-0.9NAD-specific glutamate dehydrogenase encoded in antisense gene pair with dnaKJ
Pytap_DAOMBR444maker-pag1_scaffold_291-fgenesh-gene-0.2Heat shock 70 kDa protein, mitochondrial

Sequence
1910 bases(100 bases per row)
TTGTCCTTGAACTCAGCGTCGTGGACGTTCTCGTCCTTGTTCTCCTCGGCGCCACCCTGCTGCGACTTGTACACGGCCTCACCAATCTTCATCGACAGCT
TCTGCACCTCCTCAACAGCGGTCTTGATGGCATCAGCGTCCTCACCCTCAGCGGCTGTTCGCAGGTTCTGGATGGCGGTCTTGACCTGCTCGGCGGTCTC
GCCGTCAACCTTGTCCTCGTGCTCCTTGAGGGTCTTCTCGGTCGTGTAAGCgaCCGAaTCAGCCTCGTTCTTGGCCTCAATGAGAGCCTTACGCTTCTGG
TCAGCCTCGGCGTTCATCTCAGCCTCCTGGACCATGCGCTCAATGTCGGCGTCCGAAAGACCACCGCTCGACTGGATGACAATGCTCTGCTCCTTACCGG
TCGACTTGTCACGGGCGCTGACGTTCACAATACCGTTGGCGTCAATGTCGAAGGTGACCTCAATCTGTGGGACACCACGAGGGGCTGGTGGGATACCAAC
AAGGTCGAAGTTGCCGAGGAGCTTGTTGTCAGCAGCCATCTCACGCTCACCCTGGAGCACCTTAATGCCGACCTGGGTCTGCGAGTCAGCAGCCGTCGAG
AACACCTGCGACTTCTTGGTTGGGATCGTGGTGTTACGTGGGATGAGCTTGGTAAaGACACCACCAAGGGTCTCAATACCGAGCGACAGCGGGGTCACAT
CGAGGAGGAGGATGTCCTTGACGTCACCACGGAGGACACCACCCTGGATGGCGGCACCCATGGCAACGACCTCATCTGGGTTCACGCCCTTCGATGGCTT
CTTGCCGAAGAATTCCTCAACCGACTGCTGCACCTTTGGCATACGCGACATACCACCAACAAGGATGACCTCGTTGATGTCCTTCTTGTCGAGGCCGGCG
TCCTTGACACACTTCTTGCACGGACCCATAGTGCGCTCAACGAGGCCGCTCACAAGCTTCTCGAAGGTGGCACGCGTGATCTTCATGTTCAAGTGCTTAG
GACCAGTGGCGTCGGCCGTGATGAACGGAAGGCTGATGTCCGTCTGGGCAAGACCGTCGAGTTCACGCTTGGCCTTCTCAGCGGCCTCACGGAGACGCTG
CATGGCGAGATTGTCGCCCGAAAGGTCGATGCTGGTCTCCTTCTTGAACTCAGCCACGAGGTAGCGGAGGAGCTCCTCGTCGAAGTCCTCACCACCGAGG
AGGGTGTCACCGTTGGTGGCCTTCACCTCGAAGACACCACCCGAGATCTCAAGGATCGACACATCGAAGGTACCACCACCAAGGTCGAAGACGGCAATGA
ctttGCCATCAGCCTTGTCGAGACCGTAAGCGAGcGCAGCGGCCGTTGGCTCGTTGATGATACGGAGCACGTCAAGACCAGCGATCTTACCGGCGTCCTT
GGTAGCCTGACGCTGCGAGTCGTTGAAGTAGGCTGGAACCGTCACGACAGCCTGtGAGACCGACTTGCCGAGGAAGCTGTCAGCAGTCTCCTTCATCTTG
GTGAGCACCATCGAACCGATCTGCGATGGCGAGTACTTCTTGCCCTTGGCCTCAaCCCAaGCGTCCTTGCCGTTCGGGCCTGGCACAATCTTGTACGACA
CGACCTTGGACACCTCCTGGGTTTCCTTGTCGTCGAACTTACGGCCGATCAGACGCTTGACGGCGTAGAATGTGTTATCTGGGTTGGTCACAGCCTGGCG
CTTAGCAGgCATACCGACGAGGCGCTCATCGTTCTCGAGGATAGCGACAACCGATGGCGTGGTACGGGCACCCTCGGCGTTCTCAATCACACGCGGGGTC
TTACCCTCCATCACGGCGACACAGGAGTTGGTGGTACCAAGATCGATACCGATGACCTCGGTCGCGGCGGCCGACGACAGCAGGCGCTTGGCGCCcATGG
CCGGCGCGGC