Description :
From Genome Similarity Track
Location :
Scaffold_68:4878- 6343
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_68-snap-gene-0.18Transmembrane protein

Sequence
1465 bases(100 bases per row)
ACAGATCTAGTTACGAGCATTAAGCTTTGCCATCAACGGCTCGCTTTGTGGCAAATTCTGGTGTTATCAGGGGTCCGTCTGAGCCTGGTTCTGACTCCAC
ACACTTAAAAGGGTTTAGCCGGTTAAGTCAAGTAGCCATTTTTTACATTTAAAACCGGTTAATTTGTTAATGAGCGTGCTGTTCGAACTGTTCGGTGTTC
GAAACACACCTCTTGTGAGAGTAAATGAACCCATCTCGTGATGAGATTTATGTTTCGTTTGGTGTATTTTATGTGTTAGATTTAGGAGCATAATATACCT
CACCAAACCTAAAAGAAAAAAGAGAGTAAATGGACCGGCCCTCTTTGCGCACGCCGTAAATAATCGGCGACAACCGTGAGGCAATGCTGAGAAATGCCTG
TCTAAATATACAAACGCCGCGCTAAGAGTAGAAATCGAAAATAAATCGCATTGCTCTTATGAATTTGTCGCGCCATGCATACTAAAAGTAGGCTTGCTTG
CTCTGGCAGCCTGCGCTAAGGTTCGTAATGAGTACTAAAGCAAAAGCGCGACAAGTATACGGCACCGCTCTCGCTCACAGCTTTTTGATCTTCGTCCCAC
GGCAACGACGTGACTCGATGGCCACGCCTGTCCAGGTCCTACCAGTTACTTCGGCAACCGATCAGAGATCCGACAAATCCCCCTGGATATATAAACTCTG
CCCACCAGATCCGCTCCCAACTCTGGATTTGTCGATCTCCATTAAATCCCGCTTTTTGAGCCGCGCTGCTCTCAACCGATTCAATTGCTTTGTCGCATGG
CGCAAATCAATCGGTCTCGCGGGATTCATCGCACTTGTTTTTTACCCGCTAGTGATCGTGAGTCGTGCTGAAGTTGGGCAGATTTGCGCTATCGCCTCTA
CACTGCTGCTGACGCCAACCATCATCGCTGCAGTGGCTTTTTTTCGGTACGACGTGGTGAAACTCCTGTTAAGATCGTACGATTTTTGGTTCGCGACTGT
CATCAACACATCCACGTTTGCCGTGTTTGCTATAATGATGGGCGATATTCGTTTTCTTGTGCCGATCTCGGCGTGGACAGATATCCAGGTGAACATCATG
ATCGACGCGAGTCTACGCGCTGTCAAAGTATGGCAGTTTCTCAACATTGTGGGCGTTGTCACGCACACGATGACGTGGGCGACCGTGTCCTTGCAAGTGA
TCGATCGGCTGCGAGTGTTCCCAGTCTTTCGATACAAATCCCACGAGCTACCATCTTCGTCACTTGTGACCAGTGGACTGGCGACGCTCATCGCAATCAT
TATCCGCAACATTTATCGCAAGCGCCATGGATTGAGCAAGAGAAGCAACCGACCGCTAATCGAGTGCGTAAGTTATCGTACAGATCTCCAGTATTGTCCA
TACCCGTTGGGATGGCAGCAGCGACCAAACACAGTTCAAAGTCTCAATACTGCGAATCGCCCCGA