Description :
From Genome Similarity Track
Location :
Scaffold_79:48772- 50222
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_79-snap-gene-0.37Liver stage antigen
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.22ADP-ribosylation factor 2-binding protein

Sequence
1450 bases(100 bases per row)
TGCAGTCGATGTTTCGTGGATTTACGATCCGGCGCAAGTTTGCCAACGCGCTGGAGATGGCGAAATTCGTTGGTGATGGAGATGAACTGGAGTTTGGGGA
AGTAAACTTGGACGACCTGATCCAGATACCCCCAGAGCTAGAAGATGACTGGGAGAACCCGGTGCTGCCAGCCTCTAGGCAACATCGCCGCCAACATTTC
AGTGTACCTCAAGCCAATGACCTGAACGAGTGTGACGATGCGGGCAACGAGGAAGGACCAGAGAGTGGGGACTATGAAGATGAGCCGCGAGGGAGAGACA
AAGATTACTACCAACGTGCGCCTGTGGATGGGAACTACTCTGGCGAATCAGTCTCAAACACAACTGGTTGCTATGGCGGTGGTGGCAATCAGGCTCCCAA
CATTGTGACGCAAGCTCCAAGTACTAGAAACGAGCAGCTCCCACCTCAACAAGATCCAGCACCACCAGCGGCCCCAGCTCCGCCTGCCAATTTGGCGTCA
ACTCTGTGGGACAAAATGCGCAAAATGAAGCAGAAGCAGCGCCATGCAGCTGAAGAGCGGTCGCGCGAGCAAGACCCGACGTACCGGCTCCAGAAAATCA
TGAAGAAGAATAAGTCGTCGTCTAGAACCTCAAACAACAACACCACCACCCAGGTACACGGTAGCTCCACCACCACAGCGCCACACGTTCCTCCAGCGAC
AATCTCATGGGGCTCGTCTAACGGAAATGGCGAGAAGAAGAAGCCAAAAGTCAAGCTGCCGTCGCTTGTCGAGCGGCTCCGCAAGAAAACCGAGGCTGCG
CGATGATAATGATCAGCGTGGGAACGAGACCCAGTGTATCAACTCTTTACCGTTCAGAACTCGTTCTCGTGCTACTTCTTCGCTAGCGCTTGGCTAGCAG
GAGCGACTCTTTCGTCTGCTTCATCATGAGCACGAACACGTCAAAGTCGGCGGTGGCGACCAGGATCTCAGAGCACAGCACAATGCTCGACTCGCGGTCG
TTCTCGTACGCGTGGCGCACCAGGCGGTAGAACTCCTTCACACTTGACCCTTGGGACACGATATACGCTGTTTGGAGGATACAGGAATGGCGAAACACGT
GTGGTGAGGCACTCCTCCAACACAACATTGTGAGCCGATTATTGACAAGGCATACCTTCCAGTTTGGCTTCGAAGAGCTCGAGGAACTGATTGTAGATAT
CCGTGTACTCGAGCTTCATCTCCTCACTGTCGAGGTCGAAGTTGTGACAGTGCGTCTCCGCGAATCGCTCGAAAGTCTGTGCGAACTCGTCGTCGTCAAA
GAAGAACGCGATCACTTTGTTCACGATATCGGATCCGCCGTTGTCGCCTTCGCCCGCGTCCTTGCTGCCATCTTTCGAGTCTGCTCTCGTTGATTTCTTC
AGACTGAGCGTCTCCTTGGATTCACTGCTGCTGGAGGATTTCTTCTCGTC