Description :
From Genome Similarity Track
Location :
Scaffold_142:48762- 51699
Sequence
2937 bases(100 bases per row)
GAGCTGGACTCATCCTCTAATTTAGACGAGAATGTCCTTGAGAGTACAAATGCAGCAATTAGTGCGCGCAGTGGATCGTGGATACTTAAAAGACCTTATA
GTTCCTGTCATTCGAAAAAAAAATTATATTTATCCTACCTCCCCACAGACGTATACGCCATGAATTGACTTGATCCCTGGGACAAAATATTGTGTCACAC
GACAATGGCCCTTGCCTGAGGAGCAGTGCGGTTTCATTGATAAGTTCTTTCGTGCAAAGCACGCGACAGGTATGGAGCATGAGATTATATCTCCACACTC
TGCACCTACCTTTTGTGTAAAAAATACTAATGACAAGTGGCGCATTATTCATGCTTACAATGAGCTCATCCCTTCCATTATTTCAGCACAGACGACCTTT
CTGGAAAGGATGTTCTTCAGAACAACTTGGTTGGTTGTACCGTGTACAGCGCACTCGACAAGTCCATGGTTATTACTCGTGCAAGCGAGTATAATCCACT
CACAGCGCTTAGTACACCGAGCAGCATGCGCTGGGAGTGTCTAGTAATGGCCTTGGAACTATCAAATTACCCGGTAACATTTTATCTTCTGGTGTCGCAA
CTGTTTTTCCCTCACAGATTACGGGATATACTTATTTTGATGATATCTTTGTCCATGGTCGAGCATAGACGGATGTGGGAAATCGCATCGGGCATTTGCG
AGCAGTTCTCGAGTACATGCGCATCAATAAGCTACACGCAATACCTAGAAGCGCATTACTGGTGCTGAGGGGATTTCCTTTCTAGGTGTTGCATAGGGAA
GGGTGGCCTGAGAGCTGACCTTGCAATGGTCAGTTTGTTGGCCGGTGCCTAAGAACCAAAATGACTTGCCTAATTGACATGACCTTACTAATTACTGACA
CAAATTTACATGGATGATGCATTCAAGGCCAAAAATGAGAGCCCCTCATGCCCTGATTTTGGCCTTGCCGGACCCAGAGAGGTCTGTTGGTGGACATGAC
ACGAGAGTCAAGCACACATGTCCGAGCTGTCGAGTACTCTAAAGATGGTGACGACAAGAAAATTGCCTGTCTACATAGCGAGCCCCACTATACAATTTCA
GTAAGTGGAACACATCTGCATCTCCAGGTGTGACGATATAATTCTGGTTGCTCGCTTCCTCGTACTTCGTTCTTAATCAGATCGAACAGCTTGTGATTCG
AGTCTTGCATGGAGTGGATGTTTTACGATACCGGTGAACATGATGTTGGTGCTCGCTGCCACATCCAGATATGACGAGATATCCACCACAAACGTCAAGC
CGAGCCATGTAATTAATTGCCTAGGGACTTGTCCCCAGTACATTTGCGTGCTGCCGCTGACATTTGTCCTCAATCTCTCTTGAAATACCTAGCGGGTGGC
AGTCGCCTTGTACTCCCGCTAGATGGGGCCCGCGGTTGTAATAATCCTGTAAAGAACCATCCAAGTTCATGATAAAGAGCTACTTGCGATGAAGTATGCT
TGCTTAACTTCAGAGTGTATCTACTTGGCTAGCAGCCGATTGTGGAATACCAATCATGTATCATCACGCACGGCGACTCAATCGACTCATCTCTCACAGA
TAATCAGTCAACGTTGTCATTTTTGCGGAATATAACTTAAAGGTGACATATAAGCCAGGAAAGTAGAACGCTTTGGCGGATGCATTGTCACGCAGATCTA
AGTATGAGCTTCCTCGTGTGACGACTTGTCGTCGTACGTTTCGGACTTGATCCATGCGGATTATGTACGTAATGATCACTGCGTAGCTTCGCTACATGCT
CCTGGAGGGGATTGCCTAAAAAGAGTCGGACATGCAATTGTCAACACGCTGGCGTGCGCGGCTAAATTGGTATAGTATTCATCAAGGTCTATTGCGCTAT
CCCACAAAACTTGAGAATGCTCTTCGTATTGTTATTCCTTATGATGAGGAGTACGATGATTAAGCATCAGATCCTCTATGAGGCACATGATACTGCGTTA
AACGGTCATTTTCGTCATGCGACGACCTATCGCTTAGTCACCCAGAGCTGTTGATTATATATGAGTATGCACACATGTGCGCAGGTGTCATCAGTTTAAA
CCTGCTAACGTGCGTCTATGTGACTGGAGAGTCTACACACGGGCTTTGGGGGTCCCTTAGCATAGATTTGTATTTGGTCTTGCGAAAGATTTGGATGGCA
ACACTGGTATTGTAGTTTTGCCGACCGCTTGGGAAAGGTATCCTACGTAGCGGCTGTGATGGATCGATTAATGGTGGGGTTACAGATCAGCTGTTTATCG
ATCGAGTGTCTCGCCAACACGGTCTTCCTGTGGAAAAGGTCTCTGATCAAACCCTCATTTTCAAGACAGTCTTAAAAGTCCATCTTGCATTTGCTTGGTA
GCCGTTTGGACATGTCACGTCGGAATATCCACTGACCGGTGGTTTCAGAGCGCTCGTTGATCCAATTGTTGAGAATATACGCTGCAGCGTGTGTTCTGAA
TGCTCCTGGGAGTTTAGAATCGATGCTTCCCTTTGTTAAGTTTGCTTTACAAAAATTTCCCACATGCCTCTACTGGCTAGACGACGTCTGTGTGTTTTAT
GTCAACGGCCTTACGCAACCTCGCGTTCCGTTAACAATCCCACACGTTGGGATTGATACGAGAAAACTTGCCAATCGGCTTGCAGATGTAAGCTGAGCTT
CTCTCCAAAAGCAGGTGAGCGCGTTCCTATCTGCGCGCTTTAAGCCATATGGATGATACAATAGCTGCAATCCACTATGAATAAAAGAAACGAGCGGATG
CTAAAGTTGTAGGGTGTACTAAAAGTAATCGAGATCGAAGATCAAGTATTACTAAATGCGAAGAACCTACATCAAATTTAGTGTCTGCAGTGTTCAAGAC
AAATCTGCACCCGCGCTTTATCGGACTCATAATGGTC